Quick Order

Text Size:AAA

Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse GART cDNA Clone Product Information
NCBI RefSeq:AK168445.1
RefSeq ORF Size:1302bp
cDNA Description:Full length Clone DNA of Mus musculus phosphoribosylglycinamide formyltransferase with C terminal His tag.
Gene Synonym:Gaps, Prgs
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52285-ACG$225
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52285-ACR$225
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52285-ANG$225
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52285-ANR$225
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-Flag tagMG52285-CF$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-His tagMG52285-CH$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-Myc tagMG52285-CM$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, C-HA tagMG52285-CY$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone in cloning vectorMG52285-G$75
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-Flag tagMG52285-NF$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-His tagMG52285-NH$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-Myc tagMG52285-NM$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmid, N-HA tagMG52285-NY$195
Mouse GART/Glycinamide ribonucleotide transformylase Gene ORF cDNA clone expression plasmidMG52285-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: MG52285-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"