GALE cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51770-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GALE Reagents
CRO Services
Product recommended

All GALE Reagents
GALE cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Description
Full length Clone DNA of Mouse galactose-4-epimerase, UDP with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GALE cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2310002A12Rik cDNA ORF Clone, Mouse;AI323962 cDNA ORF Clone, Mouse
GALE Background Information

UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is primarily part of a larger sugar called lactose, which is found in all dairy products and many baby formulas. UDP galactose-4'-epimerase catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. Defects in GALE causes epimerase-deficiency galactosemia (EDG), also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation.

Full Name
UDP-galactose-4-epimerase
References
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Lee KA. et al., 2011,. J Biol Chem. 286 (48): 41530-8.
  • McCorvie TJ. et al., 2012, Biochim Biophys Acta. 1822 (10): 1516-26.
  • GALE cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GALE cDNA ORF Clone in Cloning Vector, Mouse MG51770-G
    GALE cDNA ORF Clone, Mouse, untagged MG51770-UT
    GALE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51770-ACG
    GALE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51770-ACGLN
    GALE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51770-ANG
    GALE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51770-ACR
    GALE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51770-ANR
    GALE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51770-CF
    GALE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51770-NF
    GALE cDNA ORF Clone, Mouse, C-His tag MG51770-CH
    GALE cDNA ORF Clone, Mouse, N-His tag MG51770-NH
    GALE cDNA ORF Clone, Mouse, C-HA tag MG51770-CY
    GALE cDNA ORF Clone, Mouse, N-HA tag MG51770-NY
    GALE cDNA ORF Clone, Mouse, N-Myc tag MG51770-NM
    GALE qPCR Primer Pairs, Mouse MP201643

    GALE cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GALE cDNA ORF Clone in Cloning Vector, Human HG14810-G
    GALE cDNA ORF Clone, Human, untagged HG14810-UT
    GALE cDNA ORF Clone, Human, C-GFPSpark® tag HG14810-ACG
    GALE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14810-ACGLN
    GALE cDNA ORF Clone, Human, N-GFPSpark® tag HG14810-ANG
    GALE cDNA ORF Clone, Human, C-OFPSpark® tag HG14810-ACR
    GALE cDNA ORF Clone, Human, N-OFPSpark® tag HG14810-ANR
    GALE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14810-CF
    GALE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14810-NF
    GALE cDNA ORF Clone, Human, C-His tag HG14810-CH
    GALE cDNA ORF Clone, Human, N-His tag HG14810-NH
    GALE cDNA ORF Clone, Human, C-HA tag HG14810-CY
    GALE cDNA ORF Clone, Human, N-HA tag HG14810-NY
    GALE cDNA ORF Clone, Human, C-Myc tag HG14810-CM
    GALE cDNA ORF Clone, Human, N-Myc tag HG14810-NM
    GALE qPCR Primer Pairs, Human HP103442
    info info
    添加购物车成功! 添加购物车失败!