Quick Order

Text Size:AAA

Mouse UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse GALE cDNA Clone Product Information
NCBI RefSeq:NM_178389.3
RefSeq ORF Size:1044bp
cDNA Description:Full length Clone DNA of Mus musculus galactose-4-epimerase, UDP with C terminal His tag.
Gene Synonym:AI323962, 2310002A12Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mouse UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Product nameProduct name
Background

UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is primarily part of a larger sugar called lactose, which is found in all dairy products and many baby formulas. UDP galactose-4'-epimerase catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. Defects in GALE causes epimerase-deficiency galactosemia (EDG), also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation.

References
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Lee KA. et al., 2011,. J Biol Chem. 286 (48): 41530-8.
  • McCorvie TJ. et al., 2012, Biochim Biophys Acta. 1822 (10): 1516-26.
  • Size / Price
    Catalog: MG51770-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"