Quick Order

Text Size:AAA

Mouse UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse GALE cDNA Clone Product Information
    NCBI RefSeq:NM_178389.3
    RefSeq ORF Size:1044bp
    cDNA Description:Full length Clone DNA of Mus musculus galactose-4-epimerase, UDP with C terminal HA tag.
    Gene Synonym:AI323962, 2310002A12Rik
    Species:Mouse
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GALE qPCR primers for gene expression analysis, MP201643 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Mouse UDP galactose-4'-epimerase / GALE Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
    Product nameProduct name
    Background

    UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is primarily part of a larger sugar called lactose, which is found in all dairy products and many baby formulas. UDP galactose-4'-epimerase catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. Defects in GALE causes epimerase-deficiency galactosemia (EDG), also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation.

    References
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Lee KA. et al., 2011,. J Biol Chem. 286 (48): 41530-8.
  • McCorvie TJ. et al., 2012, Biochim Biophys Acta. 1822 (10): 1516-26.
  • Size / Price
    Catalog: MG51770-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"