GAD65 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50653-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GAD65 Reagents
CRO Services
Product recommended

All GAD65 Reagents
GAD65 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Description
Full length Clone DNA of Mouse glutamic acid decarboxylase 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GAD65 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
6330404F12Rik cDNA ORF Clone, Mouse;GAD(65) cDNA ORF Clone, Mouse;Gad-2 cDNA ORF Clone, Mouse;GAD65 cDNA ORF Clone, Mouse
GAD65 Background Information

Glutamate decarboxylase 2, also known as glutamate decarboxylase 65 kDa isoform, 65 kDa glutamic acid decarboxylase, GAD2 and GAD65, is a member of the group II decarboxylase family. GAD2 is identified as a major autoantigen in insulin-dependent diabetes. GAD2 is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. GAD2 may also play a role in the stiff man syndrome. GAD2 is implicated in the formation of the gamma-aminobutyric acid (GABA), a neurotransmitter involved in the regulation of food intake. GABA is synthesized in brain by two isoforms of glutamic acid decarboxylase (Gad), GAD1 and GAD2. GAD1 provides most of the GABA in brain, but GAD2 can be rapidly activated in times of high GABA demand. Mice lacking GAD2 are viable whereas deletion of GAD1 is lethal. Deletion of GAD2 increased ethanol palatability and intake and slightly reduced the severity of ethanol-induced withdrawal.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
References
  • Karlsen A.E., et al.,(1991), Cloning and primary structure of a human islet isoform of glutamic acid decarboxylase from chromosome 10. Proc. Natl. Acad. Sci. U.S.A. 88:8337-8341.
  • Bu D.-F., et al., (1992), Two human glutamate decarboxylases, 65-kDa GAD and 67-kDa GAD, are each encoded by a single gene.Proc. Natl. Acad. Sci. U.S.A. 89:2115-2119.
  • Bu D.-F., et al.,(1994), The exon-intron organization of the genes (GAD1 and GAD2) encoding two human glutamate decarboxylases (GAD67 and GAD65) suggests that they derive from a common ancestral GAD.Genomics 21:222-228.
  • GAD65 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GAD65 cDNA ORF Clone in Cloning Vector, Mouse MG50653-M
    GAD65 cDNA ORF Clone, Mouse, untagged MG50653-UT
    GAD65 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50653-ACGLN
    GAD65 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50653-ACG
    GAD65 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50653-ACR
    GAD65 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50653-CF
    GAD65 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50653-NF
    GAD65 cDNA ORF Clone, Mouse, C-His tag MG50653-CH
    GAD65 cDNA ORF Clone, Mouse, N-His tag MG50653-NH
    GAD65 cDNA ORF Clone, Mouse, C-HA tag MG50653-CY
    GAD65 cDNA ORF Clone, Mouse, C-Myc tag MG50653-CM
    GAD65 cDNA ORF Clone, Mouse, N-Myc tag MG50653-NM
    GAD65 qPCR Primer Pairs, Mouse MP200633

    GAD65 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GAD65 cDNA ORF Clone in Cloning Vector, Human HG17802-G
    GAD65 cDNA ORF Clone, Human, untagged HG17802-UT
    GAD65 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17802-ACGLN
    GAD65 cDNA ORF Clone, Human, C-GFPSpark® tag HG17802-ACG
    GAD65 cDNA ORF Clone, Human, N-GFPSpark® tag HG17802-ANG
    GAD65 cDNA ORF Clone, Human, C-OFPSpark® tag HG17802-ACR
    GAD65 cDNA ORF Clone, Human, N-OFPSpark® tag HG17802-ANR
    GAD65 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17802-CF
    GAD65 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17802-NF
    GAD65 cDNA ORF Clone, Human, C-His tag HG17802-CH
    GAD65 cDNA ORF Clone, Human, N-His tag HG17802-NH
    GAD65 cDNA ORF Clone, Human, C-HA tag HG17802-CY
    GAD65 cDNA ORF Clone, Human, N-HA tag HG17802-NY
    GAD65 cDNA ORF Clone, Human, C-Myc tag HG17802-CM
    GAD65 cDNA ORF Clone, Human, N-Myc tag HG17802-NM
    info info
    添加购物车成功! 添加购物车失败!