GABARAPL1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52711-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GABARAPL1 Reagents
CRO Services
Product recommended

All GABARAPL1 Reagents
GABARAPL1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
354 bp
Description
Full length Clone DNA of Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GABARAPL1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
3110025G09Rik cDNA ORF Clone, Mouse;9130422N19Rik cDNA ORF Clone, Mouse;AI196471 cDNA ORF Clone, Mouse;Apg8l cDNA ORF Clone, Mouse;Atg8l cDNA ORF Clone, Mouse;GECI cDNA ORF Clone, Mouse;MNCb-0091 cDNA ORF Clone, Mouse
GABARAPL1 Background Information

ATG8, also known as GABARAPL1, is a ubiquitin-like protein which has a crystal structure. ATG8 consists of a 5-stranded β-sheet, which is enclosed by two α-helices at one side and one α-helix at the other side and exhibits a conserved GABARAP domain. It functions in the formation of autophagosomal membranes. The transient conjugation of ATG8 to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Autophagy is induced upon nutrient depletion or rapamycin treatment and leads to the response of more than 30 autophagy-related (ATG) genes known so far, including ATG8.

Full Name
GABA(A) receptor-associated protein like 1
References
  • Ohsumi Y, et al. (2004) The crystal structure of microtubule-associated protein light chain 3, a mammalian homologue of Saccharomyces cerevisiae Atg8. Genes Cells. 9(7):611-8.
  • Geng J, et al. (2008) The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep. 9(9):859-644.
  • Suzuki NN, et al. (2005) The crystal structure of plant ATG12 and its biological implication in autophagy. Autophagy. 1(2):119-126.
  • info info
    添加购物车成功! 添加购物车失败!