Text Size:AAA

Mouse ATG8/GABARAPL1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse GABARAPL1 cDNA Clone Product Information
    NCBI RefSeq:NM_020590.4
    RefSeq ORF Size:354bp
    cDNA Description:Full length Clone DNA of Mus musculus gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 with C terminal GFPSpark tag.
    Gene Synonym:GECI; Apg8l; Atg8l; AI196471; MNCb-0091; 3110025G09Rik; 9130422N19Rik
    Species:Mouse
    Vector:pCMV3-C-GFPSpark
    Plasmid:
    Restriction Site:
    Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GABARAPL1 qPCR primers for gene expression analysis, MP202582 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    GFPSpark Tag Info

    GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

    Product nameProduct name
    Background

    ATG8, also known as GABARAPL1, is a ubiquitin-like protein which has a crystal structure. ATG8 consists of a 5-stranded β-sheet, which is enclosed by two α-helices at one side and one α-helix at the other side and exhibits a conserved GABARAP domain. It functions in the formation of autophagosomal membranes. The transient conjugation of ATG8 to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Autophagy is induced upon nutrient depletion or rapamycin treatment and leads to the response of more than 30 autophagy-related (ATG) genes known so far, including ATG8.

    References
  • Ohsumi Y, et al. (2004) The crystal structure of microtubule-associated protein light chain 3, a mammalian homologue of Saccharomyces cerevisiae Atg8. Genes Cells. 9(7):611-8.
  • Geng J, et al. (2008) The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep. 9(9):859-644.
  • Suzuki NN, et al. (2005) The crystal structure of plant ATG12 and its biological implication in autophagy. Autophagy. 1(2):119-126.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"