G6PC3 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52101-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All G6PC3 Reagents
CRO Services
Product recommended

All G6PC3 Reagents
G6PC3 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Mouse glucose 6 phosphatase, catalytic, 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

G6PC3 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
0710001K01Rik cDNA ORF Clone, Mouse;AU019276 cDNA ORF Clone, Mouse;AU045429 cDNA ORF Clone, Mouse;AV128920 cDNA ORF Clone, Mouse;AW545836 cDNA ORF Clone, Mouse;UGRP cDNA ORF Clone, Mouse
G6PC3 Background Information
Full Name
glucose 6 phosphatase, catalytic, 3

G6PC3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
G6PC3 cDNA ORF Clone in Cloning Vector, Mouse MG52101-G
G6PC3 cDNA ORF Clone, Mouse, untagged MG52101-UT
G6PC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52101-ACGLN
G6PC3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52101-ACG
G6PC3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52101-ACR
G6PC3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52101-CF
G6PC3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52101-NF
G6PC3 cDNA ORF Clone, Mouse, C-His tag MG52101-CH
G6PC3 cDNA ORF Clone, Mouse, N-His tag MG52101-NH
G6PC3 cDNA ORF Clone, Mouse, C-HA tag MG52101-CY
G6PC3 cDNA ORF Clone, Mouse, N-HA tag MG52101-NY
G6PC3 cDNA ORF Clone, Mouse, C-Myc tag MG52101-CM
G6PC3 qPCR Primer Pairs, Mouse MP201974

G6PC3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
G6PC3 cDNA ORF Clone in Cloning Vector, Human HG16869-U
G6PC3 cDNA ORF Clone, Human, untagged HG16869-UT
G6PC3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16869-ACG
G6PC3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16869-ACGLN
G6PC3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16869-ACR
G6PC3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16869-CF
G6PC3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16869-NF
G6PC3 cDNA ORF Clone, Human, C-His tag HG16869-CH
G6PC3 cDNA ORF Clone, Human, N-His tag HG16869-NH
G6PC3 cDNA ORF Clone, Human, C-HA tag HG16869-CY
G6PC3 cDNA ORF Clone, Human, N-HA tag HG16869-NY
G6PC3 cDNA ORF Clone, Human, C-Myc tag HG16869-CM
G6PC3 cDNA ORF Clone, Human, N-Myc tag HG16869-NM
info info
添加购物车成功! 添加购物车失败!