G3BP2 cDNA ORF Clone, Mouse, untagged

Cat: MG51488-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All G3BP2 Reagents
CRO Services
Product recommended

All G3BP2 Reagents
G3BP2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1449 bp
Description
Full length Clone DNA of Mouse GTPase activating protein (SH3 domain) binding protein 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

G3BP2 cDNA ORF Clone, Mouse, untagged Alternative Names
AA409541 cDNA ORF Clone, Mouse;E430034L04Rik cDNA ORF Clone, Mouse;G3BP cDNA ORF Clone, Mouse;mKIAA0660 cDNA ORF Clone, Mouse
G3BP2 Background Information
Full Name
GTPase activating protein (SH3 domain) binding protein 2

G3BP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
G3BP2 cDNA ORF Clone in Cloning Vector, Mouse MG51488-G
G3BP2 cDNA ORF Clone in Cloning Vector, Mouse MG5A7603-U
G3BP2 cDNA ORF Clone, Mouse, untagged MG5A7603-UT
G3BP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51488-ACGLN
G3BP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7603-ACGLN
G3BP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7603-ACG
G3BP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51488-ACG
G3BP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7603-ANG
G3BP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51488-ANG
G3BP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51488-ACR
G3BP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7603-ACR
G3BP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7603-ANR
G3BP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51488-ANR
G3BP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51488-CF
G3BP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7603-CF
G3BP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51488-NF
G3BP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7603-NF
G3BP2 cDNA ORF Clone, Mouse, C-His tag MG5A7603-CH
G3BP2 cDNA ORF Clone, Mouse, C-His tag MG51488-CH
G3BP2 cDNA ORF Clone, Mouse, N-His tag MG5A7603-NH
G3BP2 cDNA ORF Clone, Mouse, N-His tag MG51488-NH
G3BP2 cDNA ORF Clone, Mouse, C-HA tag MG51488-CY
G3BP2 cDNA ORF Clone, Mouse, C-HA tag MG5A7603-CY
G3BP2 cDNA ORF Clone, Mouse, N-HA tag MG51488-NY
G3BP2 cDNA ORF Clone, Mouse, N-HA tag MG5A7603-NY
G3BP2 cDNA ORF Clone, Mouse, C-Myc tag MG51488-CM
G3BP2 cDNA ORF Clone, Mouse, C-Myc tag MG5A7603-CM
G3BP2 cDNA ORF Clone, Mouse, N-Myc tag MG5A7603-NM
G3BP2 cDNA ORF Clone, Mouse, N-Myc tag MG51488-NM
G3BP2 qPCR Primer Pairs, Mouse MP201372

G3BP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
G3BP2 cDNA ORF Clone in Cloning Vector, Human HG20578-U
G3BP2 cDNA ORF Clone, Human, untagged HG20578-UT
G3BP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG20578-ACG
G3BP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20578-ACGLN
G3BP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG20578-ANG
G3BP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG20578-ACR
G3BP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG20578-ANR
G3BP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20578-CF
G3BP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20578-NF
G3BP2 cDNA ORF Clone, Human, C-His tag HG20578-CH
G3BP2 cDNA ORF Clone, Human, N-His tag HG20578-NH
G3BP2 cDNA ORF Clone, Human, C-HA tag HG20578-CY
G3BP2 cDNA ORF Clone, Human, N-HA tag HG20578-NY
G3BP2 cDNA ORF Clone, Human, C-Myc tag HG20578-CM
G3BP2 cDNA ORF Clone, Human, N-Myc tag HG20578-NM
info info
添加购物车成功! 添加购物车失败!