FSTL3 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50029-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FSTL3 Reagents
CRO Services
Product recommended

All FSTL3 Reagents
FSTL3 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
771 bp
Description
Full length Clone DNA of Mouse follistatin-like 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FSTL3 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
E030038F23Rik cDNA ORF Clone, Mouse;Flrg cDNA ORF Clone, Mouse
FSTL3 Background Information

Follistatin-like 3 (FLRG/Fstl3) is a secreted glycoprotein of the follistatin-module-protein family. It may have a role in leukemogenesis. FLRG/Fstl3 is a recently described member of the FST family having an overall structure and activity profile similar to that of FST, including binding and neutralization of activin. FLRG/Fstl3 is expressed in a wide range of adult tissues, not detected in hematopoietic cells except in patients with a B cell chronic leukemia and a translocation. Isoform 1 or the secreted form is a binding and antagonizing protein for members of the TGF-beta family, such us activin, BMP2 and MSTN. Inhibits activin A-, activin B-, BMP2- and MSDT-induced cellular signaling; more effective on activin A than on activin B. Involved in bone formation; inhibits osteoclast differentiationc. Involved in hematopoiesis; involved in differentiation of hemopoietic progenitor cells, increases hematopoietic cell adhesion to fibronectin and seems to contribute to the adhesion of hematopoietic precursor cells to the bone marrow stroma. Isoform 2 of FLRG/Fstl3 or the nuclear form of FLRG/Fstl3 is probably involved in transcriptional regulation via interaction with MLLT10. Modulation of activin and other TGFβ superfamily signaling is the primary mechanism of action for both follistatin (FS) and FS-like 3 (FSTL-3). FLRG/Fstl3 is likely to be a local regulator of activin action in gonadal development and gametogenesis and, further, that activin appears to have important actions in gonadal development and function that are critical for normal reproduction.

Full Name
follistatin-like 3 (secreted glycoprotein)
References
  • Sidis Y, et al. (2006) Biological activity of follistatin isoforms and follistatin-like-3 is dependent on differential cell surface binding and specificity for activin, myostatin, and bone morphogenetic proteins. Endocrinology. 147(7): 3586-97.
  • Schneyer A, et al. (2003) Differential binding and neutralization of activins A and B by follistatin and follistatin like-3 (FSTL-3/FSRP/FLRG). Endocrinology. 144(5): 1671-4.
  • Xia Y, et al. (2004) Overexpression of follistatin-like 3 in gonads causes defects in gonadal development and function in transgenic mice. Mol Endocrinol. 18(4): 979-94.
  • info info
    添加购物车成功! 添加购物车失败!