Frizzled 10 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50568-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Frizzled 10 Reagents
CRO Services
Product recommended

All Frizzled 10 Reagents
Frizzled 10 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1749 bp
Description
Full length Clone DNA of Mouse frizzled homolog 10 (Drosophila) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Frizzled 10 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
Fz-10 cDNA ORF Clone, Mouse
Frizzled 10 Background Information

Frizzled-10, also known as Fz-10, CD350 and FZD10, is a multi-pass membrane protein which belongs to the G-protein coupled receptor Fz/Smo family. Frizzled-10 / FZD10 is abundantly expressed in the cerebellum, followed by cerebral cortex, medulla and spinal cord; very low levels in total brain, frontal lobe, temporal lobe and putamen. It is weakly expressed in adult brain, heart, lung, skeletal muscle, pancreas, spleen and prostate. Frizzled-10 / FZD10 is a receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-10 / FZD10 may also be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.

Full Name
frizzled class receptor 10
References
  • Kwon H.S., et al.,(2009), Myocilin is a modulator of Wnt signaling. Mol. Cell. Biol. 29:2139-2154.
  • The MGC Project Team, et al., (2004), The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC).Genome Res. 14:2121-2127.
  • Tanaka S., et al.,(1998), A novel frizzled gene identified in human esophageal carcinoma mediates APC/beta-catenin signals.Proc. Natl. Acad. Sci. U.S.A. 95:10164-10169.
  • Frizzled 10 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Frizzled 10 cDNA ORF Clone in Cloning Vector, Mouse MG50568-M
    Frizzled 10 cDNA ORF Clone, Mouse, untagged MG50568-UT
    Frizzled 10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50568-ACG
    Frizzled 10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50568-ACGLN
    Frizzled 10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50568-ACR
    Frizzled 10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50568-CF
    Frizzled 10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50568-NF
    Frizzled 10 cDNA ORF Clone, Mouse, C-His tag MG50568-CH
    Frizzled 10 cDNA ORF Clone, Mouse, N-His tag MG50568-NH
    Frizzled 10 cDNA ORF Clone, Mouse, N-HA tag MG50568-NY
    Frizzled 10 cDNA ORF Clone, Mouse, C-Myc tag MG50568-CM
    Frizzled 10 cDNA ORF Clone, Mouse, N-Myc tag MG50568-NM
    Frizzled 10 qPCR Primer Pairs, Mouse MP200560

    Frizzled 10 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Frizzled 10 cDNA ORF Clone in Cloning Vector, Human HG16045-G
    Frizzled 10 cDNA ORF Clone, Human, untagged HG16045-UT
    Frizzled 10 cDNA ORF Clone, Human, C-GFPSpark® tag HG16045-ACG
    Frizzled 10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16045-ACGLN
    Frizzled 10 cDNA ORF Clone, Human, C-OFPSpark® tag HG16045-ACR
    Frizzled 10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16045-CF
    Frizzled 10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16045-NF
    Frizzled 10 cDNA ORF Clone, Human, C-His tag HG16045-CH
    Frizzled 10 cDNA ORF Clone, Human, N-His tag HG16045-NH
    Frizzled 10 cDNA ORF Clone, Human, C-HA tag HG16045-CY
    Frizzled 10 cDNA ORF Clone, Human, N-HA tag HG16045-NY
    Frizzled 10 cDNA ORF Clone, Human, C-Myc tag HG16045-CM
    Frizzled 10 cDNA ORF Clone, Human, N-Myc tag HG16045-NM
    info info
    添加购物车成功! 添加购物车失败!