FYTTD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53067-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FYTTD1 Reagents
CRO Services
Product recommended

All FYTTD1 Reagents
FYTTD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Mouse forty-two-three domain containing 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FYTTD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2010005M05Rik cDNA ORF Clone, Mouse;3830411L18Rik cDNA ORF Clone, Mouse;3830421F13Rik cDNA ORF Clone, Mouse;4933423A17Rik cDNA ORF Clone, Mouse;AI098218 cDNA ORF Clone, Mouse;AW539567 cDNA ORF Clone, Mouse;C85190 cDNA ORF Clone, Mouse
FYTTD1 Background Information
Full Name
forty-two-three domain containing 1

FYTTD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FYTTD1 cDNA ORF Clone in Cloning Vector, Mouse MG53067-G
FYTTD1 cDNA ORF Clone, Mouse, untagged MG53067-UT
FYTTD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53067-ACG
FYTTD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53067-ACGLN
FYTTD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53067-ANG
FYTTD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53067-ACR
FYTTD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53067-ANR
FYTTD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53067-CF
FYTTD1 cDNA ORF Clone, Mouse, C-His tag MG53067-CH
FYTTD1 cDNA ORF Clone, Mouse, N-His tag MG53067-NH
FYTTD1 cDNA ORF Clone, Mouse, C-HA tag MG53067-CY
FYTTD1 cDNA ORF Clone, Mouse, N-HA tag MG53067-NY
FYTTD1 cDNA ORF Clone, Mouse, C-Myc tag MG53067-CM
FYTTD1 cDNA ORF Clone, Mouse, N-Myc tag MG53067-NM

FYTTD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FYTTD1 cDNA ORF Clone in Cloning Vector, Human HG16920-U
FYTTD1 cDNA ORF Clone, Human, untagged HG16920-UT
FYTTD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16920-ACGLN
FYTTD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16920-ACG
FYTTD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16920-ANG
FYTTD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16920-ACR
FYTTD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16920-ANR
FYTTD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16920-CF
FYTTD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16920-NF
FYTTD1 cDNA ORF Clone, Human, C-His tag HG16920-CH
FYTTD1 cDNA ORF Clone, Human, N-His tag HG16920-NH
FYTTD1 cDNA ORF Clone, Human, C-HA tag HG16920-CY
FYTTD1 cDNA ORF Clone, Human, N-HA tag HG16920-NY
FYTTD1 cDNA ORF Clone, Human, C-Myc tag HG16920-CM
FYTTD1 cDNA ORF Clone, Human, N-Myc tag HG16920-NM
info info
添加购物车成功! 添加购物车失败!