FXR1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50812-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FXR1 Reagents
CRO Services
Product recommended

All FXR1 Reagents
FXR1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1620 bp
Description
Full length Clone DNA of Mouse fragile X mental retardation gene 1, autosomal homolog with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FXR1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
1110050J02Rik cDNA ORF Clone, Mouse;9530073J07Rik cDNA ORF Clone, Mouse;AI851072 cDNA ORF Clone, Mouse;Fxr1h cDNA ORF Clone, Mouse;Fxr1p cDNA ORF Clone, Mouse
FXR1 Background Information
Full Name
fragile X mental retardation, autosomal homolog 1

FXR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FXR1 cDNA ORF Clone in Cloning Vector, Mouse MG50812-G
FXR1 cDNA ORF Clone, Mouse, untagged MG50812-UT
FXR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50812-ACG
FXR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50812-ACGLN
FXR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50812-ANG
FXR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50812-ACR
FXR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50812-ANR
FXR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50812-CF
FXR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50812-NF
FXR1 cDNA ORF Clone, Mouse, C-His tag MG50812-CH
FXR1 cDNA ORF Clone, Mouse, C-HA tag MG50812-CY
FXR1 cDNA ORF Clone, Mouse, N-HA tag MG50812-NY
FXR1 cDNA ORF Clone, Mouse, C-Myc tag MG50812-CM
FXR1 cDNA ORF Clone, Mouse, N-Myc tag MG50812-NM
FXR1 qPCR Primer Pairs, Mouse MP200783

FXR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FXR1 cDNA ORF Clone in Cloning Vector, Human HG10615-M
FXR1 cDNA ORF Clone, Human, untagged HG10615-UT
FXR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10615-ACGLN
FXR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10615-ACG
FXR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10615-ANG
FXR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10615-ACR
FXR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10615-ANR
FXR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10615-CF
FXR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10615-NF
FXR1 cDNA ORF Clone, Human, C-His tag HG10615-CH
FXR1 cDNA ORF Clone, Human, N-His tag HG10615-NH
FXR1 cDNA ORF Clone, Human, C-HA tag HG10615-CY
FXR1 cDNA ORF Clone, Human, N-HA tag HG10615-NY
FXR1 cDNA ORF Clone, Human, C-Myc tag HG10615-CM
FXR1 cDNA ORF Clone, Human, N-Myc tag HG10615-NM
FXR1 qPCR Primer Pairs, Human HP100864
info info
添加购物车成功! 添加购物车失败!