Quick Order

Mouse Folate Binding Protein/FOLR1 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse FOLR1 cDNA Clone Product Information
    NCBI RefSeq:NM_008034.2
    RefSeq ORF Size:768bp
    cDNA Description:Full length Clone DNA of Mus musculus folate receptor 1 (adult) with N terminal Flag tag.
    Gene Synonym:FBP1, Folbp1, Folbp-1, Folr1
    Species:Mouse
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FOLR1 qPCR primers for gene expression analysis, MP200565 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    The protein encoded by FOLR1 gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene.
    Folate receptor α (FRα) is the most important subunit of Folate receptor and the alpha isoform has been shown to be selectively overexpressed in cancer types like breast and ovarian cancer compared to normal breast and ovarian epithelial cells. It was determined that Folate receptor α exhibits a limited expression on the apical surfaces of the epithelial cells of normal lung, breast, thyroid, parathyroid, and kidney tissues. For their uptake of folate, normal cells rely almost exclusively on the reduced folate carrier, whereas many carcinomas and myeloid leukemia cells overexpress a high-affinity FR on their surfaces, perhaps reflecting their increased need for folate to support rapid cell division

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Senol S, Ceyran AB, Aydin A, et al. Folate receptor α expression and significance in endometrioid endometrium carcinoma and endometrial hyperplasia. International Journal of Clinical and Experimental Pathology. 2015;8(5):5633-5641.
  • Size / Price
    Catalog: MG50573-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"