Quick Order

Text Size:AAA

Mouse VEGFR3/FLT-4 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse FLT4 cDNA Clone Product Information
NCBI RefSeq:NM_008029.2
RefSeq ORF Size:4092bp
cDNA Description:Full length Clone DNA of Mus musculus FMS-like tyrosine kinase 4 with C terminal HA tag.
Gene Synonym:Chy, Flt-4, VEGFR3, VEGFR-3, AI323512, Flt4
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Vascular endothelial growth factor receptor 3 (VEGFR3), also known as FLT-4, together with the other two members VEGFR1 (FLT-1) and VEGFR2 (KDR/Flk-1) are receptors for vascular endothelial growth factors (VEGF) and belong to the class III subfamily of receptor tyrosine kinases (RTKs). The VEGFR3 protein is expressed mainly on lymphatic vessels but it is also up-regulated in tumor angiogenesis. Mutations in VEGFR3 have been identified in patients with primary lymphoedema. The VEGF-C/VEGF-D/VEGFR3 signaling pathway may provide a target for antilymphangiogenic therapy in prostate cancer, breast cancer, gastric cancer, lung cancer, non-small cell lung cancer (NSCLC), and so on.

References
  • Shushanov S, et al. (2000)VEGFc and VEGFR3 expression in human thyroid pathologies. Int J Cancer.86(1): 47-52.
  • Iljin K, et al. (2001) VEGFR3 gene structure, regulatory region, and sequence polymorphisms. FASEB J. 15(6): 1028-36.
  • Liu XE, et al. (2004) Expression and significance of VEGF-C and FLT-4 in gastric cancer. World J Gastroenterol. 10(3): 352-5.
  • Stearns ME, et al. (2004) Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis. Lab Invest. 84(6): 785-95.
  • Size / Price
    Catalog: MG50584-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"