FLRT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51922-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FLRT3 Reagents
CRO Services
Product recommended

All FLRT3 Reagents
FLRT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1950 bp
Description
Full length Clone DNA of Mouse fibronectin leucine rich transmembrane protein 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLRT3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
5530600M07Rik cDNA ORF Clone, Mouse;C430047I10Rik cDNA ORF Clone, Mouse;mKIAA1469 cDNA ORF Clone, Mouse
FLRT3 Background Information

Leucine-rich repeat transmembrane protein FLRT3, also known as Fibronectin-like domain-containing leucine-rich transmembrane protein 3, and FLRT3, is a single-pass type I membrane protein which belongs to the fibronectin leucine rich transmembrane protein (FLRT) family. FLRT3 contains one fibronectin type-III domain and ten LRR (leucine-rich) repeats and is expressed in kidney, brain, pancreas, skeletal muscle, lung, liver, placenta, and heart. It has a provocative expression pattern during somite development being expressed in regions of the somite where muscle precursor cells migrate from the dermomyotome and move into the myotome, and later in myotomal precursors destined to migrate towards their final destination. FLRT1, FLRT2 and FLRT3 are members of the FLRT family. The FLRT family of leucine-rich repeat (LRR) proteins is implicated in fibroblast growth factor (FGF) signalling, early embryonic development and neurite outgrowth. FLRT3 shares 55% amino acid sequence identity with FLRT1 and 44% identity with FLRT2. Two alternatively spliced transcript variants encoding the same protein have been described. The expression of FLRT3 is controlled by fibroblast growth factors (FGFs). FLRT3 has been implicated in neurite outgrowth after nerve damage, as a positive regulator of FGF signalling and in homotypic cell adhesion. FLRT3 may have a crucial role in regulating cellular adhesion between the epithelial apical ridge and the underlying mesenchyme and in establishing the dorso-ventral position of the ridge.

Full Name
fibronectin leucine rich transmembrane protein 3
References
  • Smith TG, et al. (2006) The expression of Flrt3 during chick limb development. Int J Dev Biol. 50(8): 701-4.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.
  • Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 29(7): 497-502.
  • FLRT3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FLRT3 cDNA ORF Clone in Cloning Vector, Mouse MG51922-G
    FLRT3 cDNA ORF Clone, Mouse, untagged MG51922-UT
    FLRT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51922-ACGLN
    FLRT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51922-ACG
    FLRT3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51922-ACR
    FLRT3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51922-CF
    FLRT3 cDNA ORF Clone, Mouse, C-His tag MG51922-CH
    FLRT3 cDNA ORF Clone, Mouse, N-His tag MG51922-NH
    FLRT3 cDNA ORF Clone, Mouse, C-HA tag MG51922-CY
    FLRT3 cDNA ORF Clone, Mouse, N-HA tag MG51922-NY
    FLRT3 cDNA ORF Clone, Mouse, C-Myc tag MG51922-CM
    FLRT3 cDNA ORF Clone, Mouse, N-Myc tag MG51922-NM
    FLRT3 qPCR Primer Pairs, Mouse MP201795

    FLRT3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FLRT3 cDNA ORF Clone in Cloning Vector, Human HG11166-M
    FLRT3 cDNA ORF Clone, Human, untagged HG11166-UT
    FLRT3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11166-ACG
    FLRT3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11166-ACGLN
    FLRT3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11166-ACR
    FLRT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11166-CF
    FLRT3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11166-NF
    FLRT3 cDNA ORF Clone, Human, C-His tag HG11166-CH
    FLRT3 cDNA ORF Clone, Human, N-His tag HG11166-NH
    FLRT3 cDNA ORF Clone, Human, C-HA tag HG11166-CY
    FLRT3 cDNA ORF Clone, Human, N-HA tag HG11166-NY
    FLRT3 cDNA ORF Clone, Human, C-Myc tag HG11166-CM
    FLRT3 cDNA ORF Clone, Human, N-Myc tag HG11166-NM
    FLRT3 qPCR Primer Pairs, Human HP101073
    info info
    添加购物车成功! 添加购物车失败!