FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51529-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FLOT1/Flotillin 1 Reagents
CRO Services
Product recommended

All FLOT1/Flotillin 1 Reagents
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1287 bp
Description
Full length Clone DNA of Mouse flotillin 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
reggie-2 cDNA ORF Clone, Mouse
FLOT1/Flotillin 1 Background Information
Full Name
flotillin 1

FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FLOT1/Flotillin 1 cDNA ORF Clone in Cloning Vector, Mouse MG51529-U
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, untagged MG51529-UT
FLOT1/Flotillin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51529-ACGLN
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51529-ACG
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51529-ANG
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51529-ACR
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51529-ANR
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51529-CF
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51529-NF
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, C-His tag MG51529-CH
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-His tag MG51529-NH
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, C-HA tag MG51529-CY
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, N-HA tag MG51529-NY
FLOT1/Flotillin 1 cDNA ORF Clone, Mouse, C-Myc tag MG51529-CM
FLOT1/Flotillin 1 qPCR Primer Pairs, Mouse MP201413

FLOT1/Flotillin 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FLOT1/Flotillin 1 cDNA ORF Clone in Cloning Vector, Human HG18388-U
FLOT1/Flotillin 1 cDNA ORF Clone, Human, untagged HG18388-UT
FLOT1/Flotillin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18388-ACG
FLOT1/Flotillin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18388-ACGLN
FLOT1/Flotillin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18388-ACR
FLOT1/Flotillin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18388-CF
FLOT1/Flotillin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18388-NF
FLOT1/Flotillin 1 cDNA ORF Clone, Human, C-His tag HG18388-CH
FLOT1/Flotillin 1 cDNA ORF Clone, Human, N-His tag HG18388-NH
FLOT1/Flotillin 1 cDNA ORF Clone, Human, C-HA tag HG18388-CY
FLOT1/Flotillin 1 cDNA ORF Clone, Human, N-HA tag HG18388-NY
FLOT1/Flotillin 1 cDNA ORF Clone, Human, C-Myc tag HG18388-CM
FLOT1/Flotillin 1 cDNA ORF Clone, Human, N-Myc tag HG18388-NM
info info
添加购物车成功! 添加购物车失败!