FLCN cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52869-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FLCN Reagents
CRO Services
Product recommended

All FLCN Reagents
FLCN cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1740 bp
Description
Full length Clone DNA of Mouse folliculin with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLCN cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AU014660 cDNA ORF Clone, Mouse;B430214A04Rik cDNA ORF Clone, Mouse;Bhd cDNA ORF Clone, Mouse;FLCL cDNA ORF Clone, Mouse
FLCN Background Information
Full Name
folliculin

FLCN cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FLCN cDNA ORF Clone in Cloning Vector, Mouse MG52869-G
FLCN cDNA ORF Clone, Mouse, untagged MG52869-UT
FLCN cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52869-ACG
FLCN Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52869-ACGLN
FLCN cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52869-ANG
FLCN cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52869-ACR
FLCN cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52869-ANR
FLCN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52869-CF
FLCN cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52869-NF
FLCN cDNA ORF Clone, Mouse, C-His tag MG52869-CH
FLCN cDNA ORF Clone, Mouse, N-His tag MG52869-NH
FLCN cDNA ORF Clone, Mouse, C-HA tag MG52869-CY
FLCN cDNA ORF Clone, Mouse, N-HA tag MG52869-NY
FLCN cDNA ORF Clone, Mouse, N-Myc tag MG52869-NM

FLCN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FLCN cDNA ORF Clone in Cloning Vector, Human HG14386-G
FLCN cDNA ORF Clone, Human, untagged HG14386-UT
FLCN cDNA ORF Clone, Human, C-GFPSpark® tag HG14386-ACG
FLCN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14386-ACGLN
FLCN cDNA ORF Clone, Human, N-GFPSpark® tag HG14386-ANG
FLCN cDNA ORF Clone, Human, C-OFPSpark® tag HG14386-ACR
FLCN cDNA ORF Clone, Human, N-OFPSpark® tag HG14386-ANR
FLCN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14386-CF
FLCN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14386-NF
FLCN cDNA ORF Clone, Human, C-His tag HG14386-CH
FLCN cDNA ORF Clone, Human, N-His tag HG14386-NH
FLCN cDNA ORF Clone, Human, C-HA tag HG14386-CY
FLCN cDNA ORF Clone, Human, N-HA tag HG14386-NY
FLCN cDNA ORF Clone, Human, C-Myc tag HG14386-CM
FLCN cDNA ORF Clone, Human, N-Myc tag HG14386-NM
FLCN qPCR Primer Pairs, Human HP103035
info info
添加购物车成功! 添加购物车失败!