FLAD1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52118-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FLAD1 Reagents
CRO Services
Product recommended

All FLAD1 Reagents
FLAD1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1479 bp
Description
Full length Clone DNA of Mouse RFad1, flavin adenine dinucleotide synthetase, homolog (yeast) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLAD1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
A930017E24Rik cDNA ORF Clone, Mouse;Pp591 cDNA ORF Clone, Mouse
FLAD1 Background Information
Full Name
flavin adenine dinucleotide synthetase 1

FLAD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FLAD1 cDNA ORF Clone in Cloning Vector, Mouse MG52118-G
FLAD1 cDNA ORF Clone, Mouse, untagged MG52118-UT
FLAD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52118-ACG
FLAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52118-ACGLN
FLAD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52118-ANG
FLAD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52118-ACR
FLAD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52118-ANR
FLAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52118-CF
FLAD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52118-NF
FLAD1 cDNA ORF Clone, Mouse, C-His tag MG52118-CH
FLAD1 cDNA ORF Clone, Mouse, C-HA tag MG52118-CY
FLAD1 cDNA ORF Clone, Mouse, N-HA tag MG52118-NY
FLAD1 cDNA ORF Clone, Mouse, C-Myc tag MG52118-CM
FLAD1 cDNA ORF Clone, Mouse, N-Myc tag MG52118-NM
FLAD1 qPCR Primer Pairs, Mouse MP201991

FLAD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FLAD1 cDNA ORF Clone in Cloning Vector, Human HG14838-G
FLAD1 cDNA ORF Clone, Human, untagged HG14838-UT
FLAD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14838-ACGLN
FLAD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14838-ACG
FLAD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14838-ACR
FLAD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14838-CF
FLAD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14838-NF
FLAD1 cDNA ORF Clone, Human, C-His tag HG14838-CH
FLAD1 cDNA ORF Clone, Human, N-His tag HG14838-NH
FLAD1 cDNA ORF Clone, Human, C-HA tag HG14838-CY
FLAD1 cDNA ORF Clone, Human, N-HA tag HG14838-NY
FLAD1 cDNA ORF Clone, Human, C-Myc tag HG14838-CM
FLAD1 cDNA ORF Clone, Human, N-Myc tag HG14838-NM
FLAD1 qPCR Primer Pairs, Human HP103469
info info
添加购物车成功! 添加购物车失败!