FKBP12 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50265-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FKBP12 Reagents
CRO Services
Product recommended

All FKBP12 Reagents
FKBP12 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
327 bp
Description
Full length Clone DNA of Mouse FK506 binding protein 1a with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FKBP12 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Fkbp cDNA ORF Clone, Mouse;Fkbp1 cDNA ORF Clone, Mouse;FKBP12 cDNA ORF Clone, Mouse
FKBP12 Background Information

FK506 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the immunophilin protein family who serve as receptors for the immunosuppressant drugs cyclosporin A and FK506. As a conserved molecules in many eukaryotes, FKBP12 has been characterized as a peptidyl-prolyl isomerase that catalyzes the transition between cis- and trans-proline residues, and is involved in several biochemical processes including protein folding, receptor signaling, protein trafficking and transcription. FKBP12 has attracted immense attention and its role in mediating the immunosuppressive functions. FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. In one such a role, FKBP12 interacts with and regulates the functional state of the ryanodine Ca2+ channel receptor by altering protein conformation and coordinating multi-protein complex formation. Another physiological role of FKBP12 is an interactor and a regulator of the type I serine/threonine kinase receptors of TGF-beta superfamily. Current data, derived from detailed biochemical studies as well as from functional studies in various systems, suggest that FKBP12 functions as a "guardian" for the type I receptors to prevent them from leaky signaling under sub-optimal ligand concentrations, thereby providing a molecular "gradient reader" for TGF-beta family morphogens. This aspect of FKBP12 function may be critical for cellular responsiveness to morphogenetic gradients of the TGF-beta family members during early development, serving to assure the translation of different ligand concentrations into different signaling readouts. In addition, FKBP12 may be involved in neuronal or astrocytic cytoskeletal organization and in the abnormal metabolism of tau protein in Alzheimer's disease (AD) damaged neurons.

Full Name
FK506 binding protein 1A
References
  • Wang T, et al. (2004) The immunophilin FKBP12: a molecular guardian of the TGF-beta family type I receptors. Front Biosci. 9: 619-31.
  • Sugata H, et al. (2009) A peptidyl-prolyl isomerase, FKBP12, accumulates in Alzheimer neurofibrillary tangles. Neurosci Lett. 459(2): 96-9.
  • Brath U, et al. (2009) Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition. J Mol Biol. 387(1): 233-44.
  • Scaramello CB, et al.. (2009) FKBP12 depletion leads to loss of sarcoplasmic reticulum Ca(2+) stores in rat vas deferens. J Pharmacol Sci. 109(2): 185-92.
  • FKBP12 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FKBP12 cDNA ORF Clone in Cloning Vector, Rat RG81138-U
    FKBP12 cDNA ORF Clone, Rat, untagged RG81138-UT
    FKBP12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81138-ACGLN
    FKBP12 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81138-ACG
    FKBP12 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81138-ANG
    FKBP12 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81138-ACR
    FKBP12 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81138-ANR
    FKBP12 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81138-CF
    FKBP12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81138-NF
    FKBP12 cDNA ORF Clone, Rat, C-His tag RG81138-CH
    FKBP12 cDNA ORF Clone, Rat, N-His tag RG81138-NH
    FKBP12 cDNA ORF Clone, Rat, C-HA tag RG81138-CY
    FKBP12 cDNA ORF Clone, Rat, N-HA tag RG81138-NY
    FKBP12 cDNA ORF Clone, Rat, C-Myc tag RG81138-CM
    FKBP12 cDNA ORF Clone, Rat, N-Myc tag RG81138-NM
    FKBP12 qPCR Primer Pairs, Rat RP301095

    FKBP12 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FKBP12 cDNA ORF Clone in Cloning Vector, Mouse MG50265-M
    FKBP12 cDNA ORF Clone, Mouse, untagged MG50265-UT
    FKBP12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50265-ACGLN
    FKBP12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50265-ACG
    FKBP12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50265-ANG
    FKBP12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50265-ACR
    FKBP12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50265-ANR
    FKBP12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50265-CF
    FKBP12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50265-NF
    FKBP12 cDNA ORF Clone, Mouse, C-His tag MG50265-CH
    FKBP12 cDNA ORF Clone, Mouse, N-His tag MG50265-NH
    FKBP12 cDNA ORF Clone, Mouse, C-HA tag MG50265-CY
    FKBP12 cDNA ORF Clone, Mouse, N-HA tag MG50265-NY
    FKBP12 cDNA ORF Clone, Mouse, C-Myc tag MG50265-CM
    FKBP12 qPCR Primer Pairs, Mouse MP200290

    FKBP12 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FKBP12 cDNA ORF Clone in Cloning Vector, Human HG10268-M
    FKBP12 cDNA ORF Clone, Human, untagged HG10268-UT
    FKBP12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10268-ACGLN
    FKBP12 cDNA ORF Clone, Human, C-GFPSpark® tag HG10268-ACG
    FKBP12 cDNA ORF Clone, Human, N-GFPSpark® tag HG10268-ANG
    FKBP12 cDNA ORF Clone, Human, C-OFPSpark® tag HG10268-ACR
    FKBP12 cDNA ORF Clone, Human, N-OFPSpark® tag HG10268-ANR
    FKBP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10268-CF
    FKBP12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10268-NF
    FKBP12 cDNA ORF Clone, Human, C-His tag HG10268-CH
    FKBP12 cDNA ORF Clone, Human, N-His tag HG10268-NH
    FKBP12 cDNA ORF Clone, Human, C-HA tag HG10268-CY
    FKBP12 cDNA ORF Clone, Human, N-HA tag HG10268-NY
    FKBP12 cDNA ORF Clone, Human, C-Myc tag HG10268-CM
    FKBP12 cDNA ORF Clone, Human, N-Myc tag HG10268-NM
    FKBP12 qPCR Primer Pairs, Human HP100316
    info info
    添加购物车成功! 添加购物车失败!