Quick Order

Mouse FGF9 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse FGF9 cDNA Clone Product Information
NCBI RefSeq:NM_013518.3
RefSeq ORF Size:627bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor 9 with N terminal HA tag.
Gene Synonym:Fgf9
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Fibroblast growth factor 9 (FGF9) also known as Glia-activating factor or Heparin-binding growth factor 9, is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. FGF9 plays an important role in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration. FGF9 may have a role in glial cell growth and differentiation during development, gliosis during repair and regeneration of brain tissue after damage, differentiation and survival of neuronal cells, and growth stimulation of glial tumors.

References
  • Giri D, et al. (1999) FGF9 is an autocrine and paracrine prostatic growth factor expressed by prostatic stromal cells. J Cell Physiol. 180(1): 53-60.
  • Schmahl J, et al. (2004) Fgf9 induces proliferation and nuclear localization of FGFR2 in Sertoli precursors during male sex determination. Development. 131(15): 3627-36.
  • Garcès A, et al. (2000) FGF9: a motoneuron survival factor expressed by medial thoracic and sacral motoneurons. J Neurosci Res. 60(1): 1-9.
  • Size / Price
    Catalog: MG50651-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"