Quick Order

Text Size:AAA

Mouse FGF7 / FGF-7 / KGF Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse FGF7 cDNA Clone Product Information
NCBI RefSeq:NM_008008.4
RefSeq ORF Size:579bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor 7.
Gene Synonym:Kgf, Fgf7
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mFGF7
Restriction Site:HindIII + XbaI (6.1kb + 0.58kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 48A>G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FGF7 Gene Plasmid Map
Mouse FGF7 / KGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: MG50394-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Mouse FGF7 / KGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"