FGF12 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50678-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGF12 Reagents
CRO Services
Product recommended

All FGF12 Reagents
FGF12 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Mouse fibroblast growth factor 12,transcript variant 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF12 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AV114868 cDNA ORF Clone, Mouse;B230343J05Rik cDNA ORF Clone, Mouse;FGF-12 cDNA ORF Clone, Mouse;FHF-1 cDNA ORF Clone, Mouse;Fhf1 cDNA ORF Clone, Mouse
FGF12 Background Information

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

Full Name
fibroblast growth factor 12
References
  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • FGF12 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    FGF12 cDNA ORF Clone in Cloning Vector, Canine DG70044-G
    FGF12 cDNA ORF Clone, Canine, untagged DG70044-UT
    FGF12 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70044-ACGLN
    FGF12 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70044-ACG
    FGF12 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70044-ANG
    FGF12 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70044-ACR
    FGF12 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70044-ANR
    FGF12 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70044-CF
    FGF12 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70044-NF
    FGF12 cDNA ORF Clone, Canine, C-His tag DG70044-CH
    FGF12 cDNA ORF Clone, Canine, N-His tag DG70044-NH
    FGF12 cDNA ORF Clone, Canine, C-HA tag DG70044-CY
    FGF12 cDNA ORF Clone, Canine, N-HA tag DG70044-NY
    FGF12 cDNA ORF Clone, Canine, C-Myc tag DG70044-CM
    FGF12 cDNA ORF Clone, Canine, N-Myc tag DG70044-NM

    FGF12 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    FGF12 cDNA ORF Clone in Cloning Vector, Rhesus CG90074-G
    FGF12 cDNA ORF Clone, Rhesus, untagged CG90074-UT
    FGF12 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90074-ACG
    FGF12 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90074-ACGLN
    FGF12 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90074-ANG
    FGF12 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90074-ACR
    FGF12 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90074-ANR
    FGF12 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90074-CF
    FGF12 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90074-NF
    FGF12 cDNA ORF Clone, Rhesus, C-His tag CG90074-CH
    FGF12 cDNA ORF Clone, Rhesus, N-His tag CG90074-NH
    FGF12 cDNA ORF Clone, Rhesus, C-HA tag CG90074-CY
    FGF12 cDNA ORF Clone, Rhesus, N-HA tag CG90074-NY
    FGF12 cDNA ORF Clone, Rhesus, C-Myc tag CG90074-CM
    FGF12 cDNA ORF Clone, Rhesus, N-Myc tag CG90074-NM

    FGF12 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGF12 cDNA ORF Clone in Cloning Vector, Mouse MG50678-M
    FGF12 cDNA ORF Clone, Mouse, untagged MG50678-UT
    FGF12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50678-ACGLN
    FGF12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50678-ACG
    FGF12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50678-ANG
    FGF12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50678-ACR
    FGF12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50678-ANR
    FGF12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50678-CF
    FGF12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50678-NF
    FGF12 cDNA ORF Clone, Mouse, C-His tag MG50678-CH
    FGF12 cDNA ORF Clone, Mouse, N-His tag MG50678-NH
    FGF12 cDNA ORF Clone, Mouse, C-HA tag MG50678-CY
    FGF12 cDNA ORF Clone, Mouse, C-Myc tag MG50678-CM
    FGF12 cDNA ORF Clone, Mouse, N-Myc tag MG50678-NM
    FGF12 qPCR Primer Pairs, Mouse MP200657

    FGF12 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGF12 cDNA ORF Clone in Cloning Vector, Human HG10312-M
    FGF12 cDNA ORF Clone, Human, untagged HG10312-UT
    FGF12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10312-ACGLN
    FGF12 cDNA ORF Clone, Human, C-GFPSpark® tag HG10312-ACG
    FGF12 cDNA ORF Clone, Human, N-GFPSpark® tag HG10312-ANG
    FGF12 cDNA ORF Clone, Human, C-OFPSpark® tag HG10312-ACR
    FGF12 cDNA ORF Clone, Human, N-OFPSpark® tag HG10312-ANR
    FGF12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10312-CF
    FGF12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10312-NF
    FGF12 cDNA ORF Clone, Human, C-His tag HG10312-CH
    FGF12 cDNA ORF Clone, Human, N-His tag HG10312-NH
    FGF12 cDNA ORF Clone, Human, C-HA tag HG10312-CY
    FGF12 cDNA ORF Clone, Human, N-HA tag HG10312-NY
    FGF12 cDNA ORF Clone, Human, C-Myc tag HG10312-CM
    FGF12 cDNA ORF Clone, Human, N-Myc tag HG10312-NM
    FGF12 qPCR Primer Pairs, Human HP100355
    info info
    添加购物车成功! 添加购物车失败!