After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse FGF12 cDNA Clone Product Information
NCBI RefSeq:NM_183064.3
RefSeq ORF Size:732bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor 12,transcript variant 1 with N terminal HA tag.
Gene Synonym:Fhf1, AV114868, Fgf12
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG50678-ACG$225
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG50678-ACR$225
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG50678-ANG$225
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG50678-ANR$225
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG50678-CF$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagMG50678-CH$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagMG50678-CM$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG50678-CY$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone in cloning vectorMG50678-M$75
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG50678-M-Y$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagMG50678-NF$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagMG50678-NH$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagMG50678-NM$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagMG50678-NY$195
Mouse FGF12 / FGF-12 transcript variant 1 Gene ORF cDNA clone expression plasmidMG50678-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

References
  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Catalog: MG50678-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"