Fetuin B cDNA ORF Clone, Mouse, C-His tag

Cat: MG50572-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Fetuin B Reagents
CRO Services
Product recommended

All Fetuin B Reagents
Fetuin B cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1167 bp
Description
Full length Clone DNA of Mouse fetuin beta with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fetuin B cDNA ORF Clone, Mouse, C-His tag Alternative Names
2310011O17Rik cDNA ORF Clone, Mouse;AI255764 cDNA ORF Clone, Mouse;D17980 cDNA ORF Clone, Mouse;Gugu cDNA ORF Clone, Mouse
Fetuin B Background Information

Fetuin-B, also known as Fetuin-like protein IRL685 and FETUB, is a secreted protein which belongs to the fetuin family. Fetuin-B / FETUB contains two cystatin domains. Fetuin-B is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption. Fetuin-A has been identified as a major protein during fetal life and is also involved in important functions such as protease inhibitory activities and development-associated regulation of calcium metabolism and osteogenesis. Fetuin-A is a key partner in the recovery phase of an acute inflammatory response. Fetuin-B / FETUB is found at least in human and rodents. It is unambiguously a paralogue of Fetuin-A. Fetuin-A and Fetuin-B exhibit significant differences at the amino acid sequence level, notably including variations with respect to the archetypal fetuin-specific signature.

Full Name
fetuin B
References
  • Olivier E., et al., 2000, Biochem. J. 350:589-97
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-80.
  • Hsu SJ, et al., 2005, Genome. 47 (5): 931-46.
  • Liu T, et al., 2006, J. Proteome Res.4 (6): 2070-80.
  • Fetuin B cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Fetuin B cDNA ORF Clone in Cloning Vector, Rat RG81641-G
    Fetuin B cDNA ORF Clone, Rat, untagged RG81641-UT
    Fetuin B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81641-ACGLN
    Fetuin B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81641-ACG
    Fetuin B cDNA ORF Clone, Rat, N-GFPSpark® tag RG81641-ANG
    Fetuin B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81641-ACR
    Fetuin B cDNA ORF Clone, Rat, N-OFPSpark® tag RG81641-ANR
    Fetuin B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81641-CF
    Fetuin B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81641-NF
    Fetuin B cDNA ORF Clone, Rat, C-His tag RG81641-CH
    Fetuin B cDNA ORF Clone, Rat, N-His tag RG81641-NH
    Fetuin B cDNA ORF Clone, Rat, C-HA tag RG81641-CY
    Fetuin B cDNA ORF Clone, Rat, N-HA tag RG81641-NY
    Fetuin B cDNA ORF Clone, Rat, C-Myc tag RG81641-CM
    Fetuin B cDNA ORF Clone, Rat, N-Myc tag RG81641-NM

    Fetuin B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Fetuin B cDNA ORF Clone in Cloning Vector, Mouse MG50572-M
    Fetuin B cDNA ORF Clone, Mouse, untagged MG50572-UT
    Fetuin B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50572-ACGLN
    Fetuin B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50572-ACG
    Fetuin B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50572-ACR
    Fetuin B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50572-CF
    Fetuin B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50572-NF
    Fetuin B cDNA ORF Clone, Mouse, N-His tag MG50572-NH
    Fetuin B cDNA ORF Clone, Mouse, C-HA tag MG50572-CY
    Fetuin B cDNA ORF Clone, Mouse, N-HA tag MG50572-NY
    Fetuin B cDNA ORF Clone, Mouse, C-Myc tag MG50572-CM
    Fetuin B cDNA ORF Clone, Mouse, N-Myc tag MG50572-NM
    Fetuin B qPCR Primer Pairs, Mouse MP200564

    Fetuin B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Fetuin B cDNA ORF Clone, Human, untagged HG11834-UT
    Fetuin B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11834-ACGLN
    Fetuin B qPCR Primer Pairs, Human HP104628
    info info
    添加购物车成功! 添加购物车失败!