Quick Order

Text Size:AAA

Mouse FETUB ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse FETUB cDNA Clone Product Information
NCBI RefSeq:NM_001083904.1
RefSeq ORF Size:1167bp
cDNA Description:Full length Clone DNA of Mus musculus fetuin beta with N terminal HA tag.
Gene Synonym:Gugu, D17980, AI255764
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Fetuin-B, also known as Fetuin-like protein IRL685 and FETUB, is a secreted protein which belongs to the fetuin family. Fetuin-B / FETUB contains two cystatin domains. Fetuin-B is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption. Fetuin-A has been identified as a major protein during fetal life and is also involved in important functions such as protease inhibitory activities and development-associated regulation of calcium metabolism and osteogenesis. Fetuin-A is a key partner in the recovery phase of an acute inflammatory response. Fetuin-B / FETUB is found at least in human and rodents. It is unambiguously a paralogue of Fetuin-A. Fetuin-A and Fetuin-B exhibit significant differences at the amino acid sequence level, notably including variations with respect to the archetypal fetuin-specific signature.

References
  • Olivier E., et al., 2000, Biochem. J. 350:589-97
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-80.
  • Hsu SJ, et al., 2005, Genome. 47 (5): 931-46.
  • Liu T, et al., 2006, J. Proteome Res.4 (6): 2070-80.
  • Size / Price
    Catalog: MG50572-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"