FDPS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51224-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FDPS Reagents
CRO Services
Product recommended

All FDPS Reagents
FDPS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1062 bp
Description
Full length Clone DNA of Mouse farnesyl diphosphate synthetase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FDPS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
6030492I17Rik cDNA ORF Clone, Mouse;AI256750 cDNA ORF Clone, Mouse;Fdpsl1 cDNA ORF Clone, Mouse;mKIAA1293 cDNA ORF Clone, Mouse
FDPS Background Information

Z-farnesyl diphosphate synthase (FDPS) is an enzyme belonging to the family of transferases, specifically those transferring aryl or alkyl groups other than methyl groups. Z-farnesyl diphosphate synthase (FDPS) functions as key enzyme in isoprenoid biosynthesis which catalyzes the formation of farnesyl diphosphate, a precurcor for several classes of essential metabolites. FDPS catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Functions of FDPS may be inactivated by interferon-induced RSAD2. This inactivation may result of disruption of lipid rafts at the plasma membrane, and thus have an antiviral effect since many enveloped viruses need lipid rafts to bud efficiently out of the cell.

Full Name
farnesyl diphosphate synthase
References
  • Pjetursson BE, et al. (2007) Comparison of survival and complication rates of tooth-supported fixed dental prostheses (FDPs) and implant-supported FDPs and single crowns (SCs). Clin Oral Implants Res. 3:97-113.
  • Eschbach S, et al. (2009) Clinical evaluation of all-ceramic posterior three-unit FDPs made of In-Ceram Zirconia. Int J Prosthodont. 22(5):490-2.
  • Moshage HJ, et al. (1990) Differential effects of endotoxin and fibrinogen degradation products (FDPS) on liver synthesis of fibrinogen and albumin: evidence for the involvement of a novel monokine in the stimulation of fibrinogen synthesis induced by FDPS. Int J Biochem. 22(12): 1393-400.
  • FDPS cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FDPS cDNA ORF Clone in Cloning Vector, Rat RG80771-U
    FDPS cDNA ORF Clone, Rat, untagged RG80771-UT
    FDPS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80771-ACGLN
    FDPS cDNA ORF Clone, Rat, C-GFPSpark® tag RG80771-ACG
    FDPS cDNA ORF Clone, Rat, N-GFPSpark® tag RG80771-ANG
    FDPS cDNA ORF Clone, Rat, C-OFPSpark® tag RG80771-ACR
    FDPS cDNA ORF Clone, Rat, N-OFPSpark® tag RG80771-ANR
    FDPS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80771-CF
    FDPS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80771-NF
    FDPS cDNA ORF Clone, Rat, C-His tag RG80771-CH
    FDPS cDNA ORF Clone, Rat, N-His tag RG80771-NH
    FDPS cDNA ORF Clone, Rat, C-HA tag RG80771-CY
    FDPS cDNA ORF Clone, Rat, N-HA tag RG80771-NY
    FDPS cDNA ORF Clone, Rat, C-Myc tag RG80771-CM
    FDPS cDNA ORF Clone, Rat, N-Myc tag RG80771-NM
    FDPS qPCR Primer Pairs, Rat RP300735

    FDPS cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FDPS cDNA ORF Clone in Cloning Vector, Mouse MG51224-U
    FDPS cDNA ORF Clone, Mouse, untagged MG51224-UT
    FDPS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51224-ACG
    FDPS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51224-ACGLN
    FDPS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51224-ANG
    FDPS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51224-ACR
    FDPS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51224-ANR
    FDPS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51224-NF
    FDPS cDNA ORF Clone, Mouse, C-His tag MG51224-CH
    FDPS cDNA ORF Clone, Mouse, N-His tag MG51224-NH
    FDPS cDNA ORF Clone, Mouse, C-HA tag MG51224-CY
    FDPS cDNA ORF Clone, Mouse, N-HA tag MG51224-NY
    FDPS cDNA ORF Clone, Mouse, C-Myc tag MG51224-CM
    FDPS cDNA ORF Clone, Mouse, N-Myc tag MG51224-NM
    FDPS qPCR Primer Pairs, Mouse MP201107

    FDPS cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FDPS cDNA ORF Clone in Cloning Vector, Human HG13229-G
    FDPS cDNA ORF Clone, Human, untagged HG13229-UT
    FDPS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13229-ACGLN
    FDPS cDNA ORF Clone, Human, C-GFPSpark® tag HG13229-ACG
    FDPS cDNA ORF Clone, Human, N-GFPSpark® tag HG13229-ANG
    FDPS cDNA ORF Clone, Human, C-OFPSpark® tag HG13229-ACR
    FDPS cDNA ORF Clone, Human, N-OFPSpark® tag HG13229-ANR
    FDPS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13229-CF
    FDPS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13229-NF
    FDPS cDNA ORF Clone, Human, C-His tag HG13229-CH
    FDPS cDNA ORF Clone, Human, N-His tag HG13229-NH
    FDPS cDNA ORF Clone, Human, C-HA tag HG13229-CY
    FDPS cDNA ORF Clone, Human, N-HA tag HG13229-NY
    FDPS cDNA ORF Clone, Human, C-Myc tag HG13229-CM
    FDPS cDNA ORF Clone, Human, N-Myc tag HG13229-NM
    FDPS qPCR Primer Pairs, Human HP102125
    info info
    添加购物车成功! 添加购物车失败!