Quick Order

Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse FDPS cDNA Clone Product Information
NCBI RefSeq:AK088601.1
RefSeq ORF Size:1062bp
cDNA Description:Full length Clone DNA of Mus musculus farnesyl diphosphate synthetase with C terminal His tag.
Gene Synonym:Fdpsl1, AI256750, mKIAA1293, 6030492I17Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51224-ACG$225
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51224-ACR$225
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51224-ANG$225
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51224-ANR$225
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-Flag tagMG51224-CF$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-His tagMG51224-CH$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-Myc tagMG51224-CM$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, C-HA tagMG51224-CY$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-Flag tagMG51224-NF$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-His tagMG51224-NH$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-Myc tagMG51224-NM$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid, N-HA tagMG51224-NY$195
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone in cloning vectorMG51224-U$75
Mouse FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmidMG51224-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Z-farnesyl diphosphate synthase (FDPS) is an enzyme belonging to the family of transferases, specifically those transferring aryl or alkyl groups other than methyl groups. Z-farnesyl diphosphate synthase (FDPS) functions as key enzyme in isoprenoid biosynthesis which catalyzes the formation of farnesyl diphosphate, a precurcor for several classes of essential metabolites. FDPS catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Functions of FDPS may be inactivated by interferon-induced RSAD2. This inactivation may result of disruption of lipid rafts at the plasma membrane, and thus have an antiviral effect since many enveloped viruses need lipid rafts to bud efficiently out of the cell.

References
  • Pjetursson BE, et al. (2007) Comparison of survival and complication rates of tooth-supported fixed dental prostheses (FDPs) and implant-supported FDPs and single crowns (SCs). Clin Oral Implants Res. 3:97-113.
  • Eschbach S, et al. (2009) Clinical evaluation of all-ceramic posterior three-unit FDPs made of In-Ceram Zirconia. Int J Prosthodont. 22(5):490-2.
  • Moshage HJ, et al. (1990) Differential effects of endotoxin and fibrinogen degradation products (FDPS) on liver synthesis of fibrinogen and albumin: evidence for the involvement of a novel monokine in the stimulation of fibrinogen synthesis induced by FDPS. Int J Biochem. 22(12): 1393-400.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"