FBXW9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53018-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FBXW9 Reagents
CRO Services
Product recommended

All FBXW9 Reagents
FBXW9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1377 bp
Description
Full length Clone DNA of Mouse F-box and WD-40 domain protein 9 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FBXW9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1110017H11Rik cDNA ORF Clone, Mouse;Fbw9 cDNA ORF Clone, Mouse
FBXW9 Background Information
Full Name
F-box and WD repeat domain containing 9

FBXW9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FBXW9 cDNA ORF Clone in Cloning Vector, Mouse MG53018-G
FBXW9 cDNA ORF Clone, Mouse, untagged MG53018-UT
FBXW9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53018-ACGLN
FBXW9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53018-ACG
FBXW9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53018-ANG
FBXW9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53018-ACR
FBXW9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53018-ANR
FBXW9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53018-CF
FBXW9 cDNA ORF Clone, Mouse, C-His tag MG53018-CH
FBXW9 cDNA ORF Clone, Mouse, N-His tag MG53018-NH
FBXW9 cDNA ORF Clone, Mouse, C-HA tag MG53018-CY
FBXW9 cDNA ORF Clone, Mouse, N-HA tag MG53018-NY
FBXW9 cDNA ORF Clone, Mouse, C-Myc tag MG53018-CM
FBXW9 cDNA ORF Clone, Mouse, N-Myc tag MG53018-NM

FBXW9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FBXW9 cDNA ORF Clone in Cloning Vector, Human HG25163-U
FBXW9 cDNA ORF Clone, Human, untagged HG25163-UT
FBXW9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25163-ACGLN
FBXW9 cDNA ORF Clone, Human, C-GFPSpark® tag HG25163-ACG
FBXW9 cDNA ORF Clone, Human, N-GFPSpark® tag HG25163-ANG
FBXW9 cDNA ORF Clone, Human, C-OFPSpark® tag HG25163-ACR
FBXW9 cDNA ORF Clone, Human, N-OFPSpark® tag HG25163-ANR
FBXW9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25163-CF
FBXW9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25163-NF
FBXW9 cDNA ORF Clone, Human, C-His tag HG25163-CH
FBXW9 cDNA ORF Clone, Human, N-His tag HG25163-NH
FBXW9 cDNA ORF Clone, Human, C-HA tag HG25163-CY
FBXW9 cDNA ORF Clone, Human, N-HA tag HG25163-NY
FBXW9 cDNA ORF Clone, Human, C-Myc tag HG25163-CM
FBXW9 cDNA ORF Clone, Human, N-Myc tag HG25163-NM
info info
添加购物车成功! 添加购物车失败!