FBXO8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52292-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FBXO8 Reagents
CRO Services
Product recommended

All FBXO8 Reagents
FBXO8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
960 bp
Description
Full length Clone DNA of Mouse F-box protein 8 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FBXO8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Fbx8 cDNA ORF Clone, Mouse
FBXO8 Background Information
Full Name
F-box protein 8

FBXO8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FBXO8 cDNA ORF Clone in Cloning Vector, Rat RG80634-U
FBXO8 cDNA ORF Clone, Rat, untagged RG80634-UT
FBXO8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80634-ACG
FBXO8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80634-ACGLN
FBXO8 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80634-ANG
FBXO8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80634-ACR
FBXO8 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80634-ANR
FBXO8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80634-CF
FBXO8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80634-NF
FBXO8 cDNA ORF Clone, Rat, C-His tag RG80634-CH
FBXO8 cDNA ORF Clone, Rat, N-His tag RG80634-NH
FBXO8 cDNA ORF Clone, Rat, C-HA tag RG80634-CY
FBXO8 cDNA ORF Clone, Rat, N-HA tag RG80634-NY
FBXO8 cDNA ORF Clone, Rat, C-Myc tag RG80634-CM
FBXO8 cDNA ORF Clone, Rat, N-Myc tag RG80634-NM
FBXO8 qPCR Primer Pairs, Rat RP300598

FBXO8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FBXO8 cDNA ORF Clone in Cloning Vector, Mouse MG52292-G
FBXO8 cDNA ORF Clone, Mouse, untagged MG52292-UT
FBXO8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52292-ACG
FBXO8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52292-ACGLN
FBXO8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52292-ANG
FBXO8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52292-ACR
FBXO8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52292-ANR
FBXO8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52292-NF
FBXO8 cDNA ORF Clone, Mouse, C-His tag MG52292-CH
FBXO8 cDNA ORF Clone, Mouse, N-His tag MG52292-NH
FBXO8 cDNA ORF Clone, Mouse, C-HA tag MG52292-CY
FBXO8 cDNA ORF Clone, Mouse, N-HA tag MG52292-NY
FBXO8 cDNA ORF Clone, Mouse, C-Myc tag MG52292-CM
FBXO8 cDNA ORF Clone, Mouse, N-Myc tag MG52292-NM
FBXO8 qPCR Primer Pairs, Mouse MP202165
info info
添加购物车成功! 添加购物车失败!