FBXO7 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52963-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FBXO7 Reagents
CRO Services
Product recommended

All FBXO7 Reagents
FBXO7 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1572 bp
Description
Full length Clone DNA of Mouse F-box protein 7 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FBXO7 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2410015K21Rik cDNA ORF Clone, Mouse;A230052G17Rik cDNA ORF Clone, Mouse;AI117679 cDNA ORF Clone, Mouse;AW260462 cDNA ORF Clone, Mouse;C85118 cDNA ORF Clone, Mouse
FBXO7 Background Information
Full Name
F-box protein 7

FBXO7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FBXO7 cDNA ORF Clone in Cloning Vector, Mouse MG52963-G
FBXO7 cDNA ORF Clone, Mouse, untagged MG52963-UT
FBXO7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52963-ACGLN
FBXO7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52963-ACG
FBXO7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52963-ANG
FBXO7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52963-ACR
FBXO7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52963-ANR
FBXO7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52963-CF
FBXO7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52963-NF
FBXO7 cDNA ORF Clone, Mouse, C-His tag MG52963-CH
FBXO7 cDNA ORF Clone, Mouse, N-His tag MG52963-NH
FBXO7 cDNA ORF Clone, Mouse, C-HA tag MG52963-CY
FBXO7 cDNA ORF Clone, Mouse, N-HA tag MG52963-NY
FBXO7 cDNA ORF Clone, Mouse, N-Myc tag MG52963-NM

FBXO7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FBXO7 cDNA ORF Clone in Cloning Vector, Human HG16457-U
FBXO7 cDNA ORF Clone, Human, untagged HG16457-UT
FBXO7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16457-ACGLN
FBXO7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16457-ACG
FBXO7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16457-ANG
FBXO7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16457-ACR
FBXO7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16457-ANR
FBXO7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16457-CF
FBXO7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16457-NF
FBXO7 cDNA ORF Clone, Human, C-His tag HG16457-CH
FBXO7 cDNA ORF Clone, Human, N-His tag HG16457-NH
FBXO7 cDNA ORF Clone, Human, C-HA tag HG16457-CY
FBXO7 cDNA ORF Clone, Human, N-HA tag HG16457-NY
FBXO7 cDNA ORF Clone, Human, C-Myc tag HG16457-CM
FBXO7 cDNA ORF Clone, Human, N-Myc tag HG16457-NM
FBXO7 qPCR Primer Pairs, Human HP105203
info info
添加购物车成功! 添加购物车失败!