Fub1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51290-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Fub1 Reagents
CRO Services
Product recommended

All Fub1 Reagents
Fub1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
402 bp
Description
Full length Clone DNA of Mouse Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fub1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
MNSFbeta cDNA ORF Clone, Mouse
Fub1 Background Information
Full Name
Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed

Fub1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Fub1 cDNA ORF Clone in Cloning Vector, Mouse MG51290-U
Fub1 cDNA ORF Clone, Mouse, untagged MG51290-UT
Fub1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51290-ACGLN
Fub1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51290-ACG
Fub1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51290-ANG
Fub1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51290-ACR
Fub1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51290-ANR
Fub1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51290-CF
Fub1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51290-NF
Fub1 cDNA ORF Clone, Mouse, C-His tag MG51290-CH
Fub1 cDNA ORF Clone, Mouse, N-His tag MG51290-NH
Fub1 cDNA ORF Clone, Mouse, N-HA tag MG51290-NY
Fub1 cDNA ORF Clone, Mouse, C-Myc tag MG51290-CM
Fub1 cDNA ORF Clone, Mouse, N-Myc tag MG51290-NM
Fub1 qPCR Primer Pairs, Mouse MP201171

Fub1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Fub1 cDNA ORF Clone in Cloning Vector, Human HG15756-G
Fub1 cDNA ORF Clone, Human, untagged HG15756-UT
Fub1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15756-ACGLN
Fub1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15756-ACG
Fub1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15756-ANG
Fub1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15756-ACR
Fub1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15756-ANR
Fub1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15756-CF
Fub1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15756-NF
Fub1 cDNA ORF Clone, Human, C-His tag HG15756-CH
Fub1 cDNA ORF Clone, Human, N-His tag HG15756-NH
Fub1 cDNA ORF Clone, Human, C-HA tag HG15756-CY
Fub1 cDNA ORF Clone, Human, N-HA tag HG15756-NY
Fub1 cDNA ORF Clone, Human, C-Myc tag HG15756-CM
Fub1 cDNA ORF Clone, Human, N-Myc tag HG15756-NM
Fub1 qPCR Primer Pairs, Human HP104348
info info
添加购物车成功! 添加购物车失败!