Fas Ligand cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50854-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Fas Ligand Reagents
CRO Services
Product recommended

All Fas Ligand Reagents
Fas Ligand cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
840 bp
Description
Full length Clone DNA of Mouse Fas ligand (TNF superfamily, member 6) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fas Ligand cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Apt1lg1 cDNA ORF Clone, Mouse;Cd95l cDNA ORF Clone, Mouse;Fasl cDNA ORF Clone, Mouse;gld cDNA ORF Clone, Mouse;Tnfsf6 cDNA ORF Clone, Mouse
Fas Ligand Background Information

Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane protein which binds to TNFRSF6/FAS. Interaction of FAS with fas Ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Fas Ligand may be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both.

Full Name
Fas ligand
References
  • Pitti R M. et al., 1998, Nature. 396 (6712): 699-703.
  • Hane M. et al., 1995, FEBS Lett. 373 (3): 265-8.
  • Schneider P. et al., 1997, J Biol Chem. 272 (30): 18827-33.
  • Fas Ligand cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Cynomolgus CG90868-G

    Fas Ligand cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Rat RG80024-M
    Fas Ligand cDNA ORF Clone, Rat, untagged RG80024-UT
    Fas Ligand Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80024-ACGLN
    Fas Ligand cDNA ORF Clone, Rat, C-GFPSpark® tag RG80024-ACG
    Fas Ligand cDNA ORF Clone, Rat, C-OFPSpark® tag RG80024-ACR
    Fas Ligand cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80024-CF
    Fas Ligand cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80024-NF
    Fas Ligand cDNA ORF Clone, Rat, C-His tag RG80024-CH
    Fas Ligand cDNA ORF Clone, Rat, N-His tag RG80024-NH
    Fas Ligand cDNA ORF Clone, Rat, C-HA tag RG80024-CY
    Fas Ligand cDNA ORF Clone, Rat, N-HA tag RG80024-NY
    Fas Ligand cDNA ORF Clone, Rat, C-Myc tag RG80024-CM
    Fas Ligand cDNA ORF Clone, Rat, N-Myc tag RG80024-NM
    Fas Ligand qPCR Primer Pairs, Rat RP300023

    Fas Ligand cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Mouse MG50854-G
    Fas Ligand cDNA ORF Clone, Mouse, untagged MG50854-UT
    Fas Ligand cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50854-ACG
    Fas Ligand Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50854-ACGLN
    Fas Ligand cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50854-ACR
    Fas Ligand cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50854-CF
    Fas Ligand cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50854-NF
    Fas Ligand cDNA ORF Clone, Mouse, C-His tag MG50854-CH
    Fas Ligand cDNA ORF Clone, Mouse, N-His tag MG50854-NH
    Fas Ligand cDNA ORF Clone, Mouse, C-HA tag MG50854-CY
    Fas Ligand cDNA ORF Clone, Mouse, N-HA tag MG50854-NY
    Fas Ligand cDNA ORF Clone, Mouse, C-Myc tag MG50854-CM
    Fas Ligand qPCR Primer Pairs, Mouse MP200825

    Fas Ligand cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Human HG13885-G
    Fas Ligand cDNA ORF Clone, Human, untagged HG13885-UT
    Fas Ligand cDNA ORF Clone, Human, C-GFPSpark® tag HG13885-ACG
    Fas Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10244-ACGLN
    Fas Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13885-ACGLN
    Fas Ligand cDNA ORF Clone, Human, C-OFPSpark® tag HG13885-ACR
    Fas Ligand cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13885-CF
    Fas Ligand cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13885-NF
    Fas Ligand cDNA ORF Clone, Human, C-His tag HG13885-CH
    Fas Ligand cDNA ORF Clone, Human, N-His tag HG13885-NH
    Fas Ligand cDNA ORF Clone, Human, C-HA tag HG13885-CY
    Fas Ligand cDNA ORF Clone, Human, N-HA tag HG13885-NY
    Fas Ligand cDNA ORF Clone, Human, C-Myc tag HG13885-CM
    Fas Ligand cDNA ORF Clone, Human, N-Myc tag HG13885-NM
    Fas Ligand qPCR Primer Pairs, Human HP100294
    info info
    添加购物车成功! 添加购物车失败!