FAM69A cDNA ORF Clone, Mouse, untagged

Cat: MG51410-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FAM69A Reagents
CRO Services
Product recommended

All FAM69A Reagents
FAM69A cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1287 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 69, member A.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM69A cDNA ORF Clone, Mouse, untagged Alternative Names
2900024C23Rik cDNA ORF Clone, Mouse;AI315274 cDNA ORF Clone, Mouse
FAM69A Background Information
Full Name
family with sequence similarity 69, member A

FAM69A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM69A cDNA ORF Clone in Cloning Vector, Mouse MG51410-U
FAM69A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51410-ACGLN
FAM69A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51410-ACG
FAM69A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51410-ANG
FAM69A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51410-ACR
FAM69A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51410-ANR
FAM69A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51410-CF
FAM69A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51410-NF
FAM69A cDNA ORF Clone, Mouse, C-His tag MG51410-CH
FAM69A cDNA ORF Clone, Mouse, N-His tag MG51410-NH
FAM69A cDNA ORF Clone, Mouse, C-HA tag MG51410-CY
FAM69A cDNA ORF Clone, Mouse, N-HA tag MG51410-NY
FAM69A cDNA ORF Clone, Mouse, C-Myc tag MG51410-CM
FAM69A cDNA ORF Clone, Mouse, N-Myc tag MG51410-NM
FAM69A qPCR Primer Pairs, Mouse MP201294

FAM69A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM69A cDNA ORF Clone in Cloning Vector, Human HG18723-U
FAM69A cDNA ORF Clone, Human, untagged HG18723-UT
FAM69A cDNA ORF Clone, Human, C-GFPSpark® tag HG18723-ACG
FAM69A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18723-ACGLN
FAM69A cDNA ORF Clone, Human, N-GFPSpark® tag HG18723-ANG
FAM69A cDNA ORF Clone, Human, C-OFPSpark® tag HG18723-ACR
FAM69A cDNA ORF Clone, Human, N-OFPSpark® tag HG18723-ANR
FAM69A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18723-CF
FAM69A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18723-NF
FAM69A cDNA ORF Clone, Human, C-His tag HG18723-CH
FAM69A cDNA ORF Clone, Human, N-His tag HG18723-NH
FAM69A cDNA ORF Clone, Human, C-HA tag HG18723-CY
FAM69A cDNA ORF Clone, Human, N-HA tag HG18723-NY
FAM69A cDNA ORF Clone, Human, C-Myc tag HG18723-CM
FAM69A cDNA ORF Clone, Human, N-Myc tag HG18723-NM
info info
添加购物车成功! 添加购物车失败!