FAM19A5 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50556-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM19A5 Reagents
CRO Services
Product recommended

All FAM19A5 Reagents
FAM19A5 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
378 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 19, member A5 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM19A5 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
Tafa-5 cDNA ORF Clone, Mouse;TAFA5 cDNA ORF Clone, Mouse;Tara-5 cDNA ORF Clone, Mouse
FAM19A5 Background Information
Full Name
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5

FAM19A5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM19A5 cDNA ORF Clone in Cloning Vector, Mouse MG50556-M
FAM19A5 cDNA ORF Clone, Mouse, untagged MG50556-UT
FAM19A5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50556-ACG
FAM19A5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50556-ACGLN
FAM19A5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50556-ACR
FAM19A5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50556-CF
FAM19A5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50556-NF
FAM19A5 cDNA ORF Clone, Mouse, C-His tag MG50556-CH
FAM19A5 cDNA ORF Clone, Mouse, N-His tag MG50556-NH
FAM19A5 cDNA ORF Clone, Mouse, N-HA tag MG50556-NY
FAM19A5 cDNA ORF Clone, Mouse, C-Myc tag MG50556-CM
FAM19A5 cDNA ORF Clone, Mouse, N-Myc tag MG50556-NM
FAM19A5 qPCR Primer Pairs, Mouse MP200548

FAM19A5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM19A5 cDNA ORF Clone in Cloning Vector, Human HG11369-M
FAM19A5 cDNA ORF Clone, Human, untagged HG11369-UT
FAM19A5 cDNA ORF Clone, Human, C-GFPSpark® tag HG11369-ACG
FAM19A5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11369-ACGLN
FAM19A5 cDNA ORF Clone, Human, C-OFPSpark® tag HG11369-ACR
FAM19A5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11369-CF
FAM19A5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11369-NF
FAM19A5 cDNA ORF Clone, Human, C-His tag HG11369-CH
FAM19A5 cDNA ORF Clone, Human, N-His tag HG11369-NH
FAM19A5 cDNA ORF Clone, Human, C-HA tag HG11369-CY
FAM19A5 cDNA ORF Clone, Human, N-HA tag HG11369-NY
FAM19A5 cDNA ORF Clone, Human, C-Myc tag HG11369-CM
FAM19A5 cDNA ORF Clone, Human, N-Myc tag HG11369-NM
FAM19A5 qPCR Primer Pairs, Human HP101251
info info
添加购物车成功! 添加购物车失败!