FAM19A2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50554-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM19A2 Reagents
CRO Services
Product recommended

All FAM19A2 Reagents
FAM19A2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
408 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 19, member A2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM19A2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
6330575M02 cDNA ORF Clone, Mouse;FAM19A2TAFA-2 cDNA ORF Clone, Mouse;Tafa-2 cDNA ORF Clone, Mouse;TAFA2 cDNA ORF Clone, Mouse
FAM19A2 Background Information

FAM19A2 belongs to the FAM19/TAFA family. FAM19/TAFA family members are chemokine-like proteins. The biological functions of TAFA family members remain to be determined, but there are a few tentative hypotheses. First, TAFAs may modulate immune responses in the CNS by functioning as brain specific chemokines, and may act with other chemokines to optimize the recruitment and activity of immune cells in the CNS. Second, TAFAs may represent a novel class of neurokines that act as regulators of immune nervous cells. And third, TAFAs may control axonal sprouting following brain injury. Human FAM19A2 is 97% aa identical to mouse FAM19A2 and is expressed in the central nervous system (CNS), colon, heart, lung, spleen, kidney, and thymus, however its expression in the CNS is 50 to 1000 fold higher than in other tissues. FAM19A2 gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins.

Full Name
family with sequence similarity 19 (chemokine (C-C motif)-like), member A2
References
  • Parsa A, et al. (2011) Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. Clin Transl Sci. 4(1):17-23.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • FAM19A2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FAM19A2 cDNA ORF Clone in Cloning Vector, Mouse MG50554-M
    FAM19A2 cDNA ORF Clone, Mouse, untagged MG50554-UT
    FAM19A2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50554-ACG
    FAM19A2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50554-ACGLN
    FAM19A2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50554-ANG
    FAM19A2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50554-ACR
    FAM19A2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50554-ANR
    FAM19A2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50554-CF
    FAM19A2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50554-NF
    FAM19A2 cDNA ORF Clone, Mouse, C-His tag MG50554-CH
    FAM19A2 cDNA ORF Clone, Mouse, N-His tag MG50554-NH
    FAM19A2 cDNA ORF Clone, Mouse, N-HA tag MG50554-NY
    FAM19A2 cDNA ORF Clone, Mouse, C-Myc tag MG50554-CM
    FAM19A2 cDNA ORF Clone, Mouse, N-Myc tag MG50554-NM
    FAM19A2 qPCR Primer Pairs, Mouse MP200546

    FAM19A2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FAM19A2 cDNA ORF Clone in Cloning Vector, Human HG11169-M
    FAM19A2 cDNA ORF Clone, Human, untagged HG11169-UT
    FAM19A2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11169-ACG
    FAM19A2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11169-ACGLN
    FAM19A2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11169-ANG
    FAM19A2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11169-ACR
    FAM19A2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11169-ANR
    FAM19A2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11169-CF
    FAM19A2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11169-NF
    FAM19A2 cDNA ORF Clone, Human, C-His tag HG11169-CH
    FAM19A2 cDNA ORF Clone, Human, N-His tag HG11169-NH
    FAM19A2 cDNA ORF Clone, Human, C-HA tag HG11169-CY
    FAM19A2 cDNA ORF Clone, Human, N-HA tag HG11169-NY
    FAM19A2 cDNA ORF Clone, Human, C-Myc tag HG11169-CM
    FAM19A2 cDNA ORF Clone, Human, N-Myc tag HG11169-NM
    FAM19A2 qPCR Primer Pairs, Human HP101076
    info info
    添加购物车成功! 添加购物车失败!