FAM136A cDNA ORF Clone, Mouse, untagged

Cat: MG52509-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FAM136A Reagents
CRO Services
Product recommended

All FAM136A Reagents
FAM136A cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
417 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 136, member A
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM136A cDNA ORF Clone, Mouse, untagged Alternative Names
2010309E21Rik cDNA ORF Clone, Mouse;AW124904 cDNA ORF Clone, Mouse;Hyccin cDNA ORF Clone, Mouse
FAM136A Background Information
Full Name
family with sequence similarity 136 member A

FAM136A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM136A cDNA ORF Clone in Cloning Vector, Mouse MG52509-U
FAM136A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52509-ACGLN
FAM136A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52509-ACG
FAM136A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52509-ANG
FAM136A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52509-ACR
FAM136A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52509-ANR
FAM136A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52509-CF
FAM136A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52509-NF
FAM136A cDNA ORF Clone, Mouse, C-His tag MG52509-CH
FAM136A cDNA ORF Clone, Mouse, N-His tag MG52509-NH
FAM136A cDNA ORF Clone, Mouse, C-HA tag MG52509-CY
FAM136A cDNA ORF Clone, Mouse, N-HA tag MG52509-NY
FAM136A cDNA ORF Clone, Mouse, C-Myc tag MG52509-CM
FAM136A cDNA ORF Clone, Mouse, N-Myc tag MG52509-NM
FAM136A qPCR Primer Pairs, Mouse MP202382

FAM136A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM136A cDNA ORF Clone in Cloning Vector, Human HG17135-U
FAM136A cDNA ORF Clone, Human, untagged HG17135-UT
FAM136A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17135-ACGLN
FAM136A cDNA ORF Clone, Human, C-GFPSpark® tag HG17135-ACG
FAM136A cDNA ORF Clone, Human, N-GFPSpark® tag HG17135-ANG
FAM136A cDNA ORF Clone, Human, C-OFPSpark® tag HG17135-ACR
FAM136A cDNA ORF Clone, Human, N-OFPSpark® tag HG17135-ANR
FAM136A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17135-CF
FAM136A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17135-NF
FAM136A cDNA ORF Clone, Human, C-His tag HG17135-CH
FAM136A cDNA ORF Clone, Human, N-His tag HG17135-NH
FAM136A cDNA ORF Clone, Human, C-HA tag HG17135-CY
FAM136A cDNA ORF Clone, Human, N-HA tag HG17135-NY
FAM136A cDNA ORF Clone, Human, C-Myc tag HG17135-CM
FAM136A cDNA ORF Clone, Human, N-Myc tag HG17135-NM
info info
添加购物车成功! 添加购物车失败!