FAM126B cDNA ORF Clone, Mouse, untagged

Cat: MG52548-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM126B Reagents
CRO Services
Product recommended

All FAM126B Reagents
FAM126B cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1761 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 126, member B.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM126B cDNA ORF Clone, Mouse, untagged Alternative Names
C130065N10Rik cDNA ORF Clone, Mouse;D1Ertd53e cDNA ORF Clone, Mouse;D630010C10 cDNA ORF Clone, Mouse
FAM126B Background Information
Full Name
family with sequence similarity 126, member B

FAM126B cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
FAM126B cDNA ORF Clone in Cloning Vector, Rabbit TG65092-G
FAM126B cDNA ORF Clone, Rabbit, untagged TG65092-UT
FAM126B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65092-ACG
FAM126B cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65092-ANG
FAM126B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65092-ACR
FAM126B cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65092-ANR
FAM126B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65092-CF
FAM126B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65092-NF
FAM126B cDNA ORF Clone, Rabbit, C-His tag TG65092-CH
FAM126B cDNA ORF Clone, Rabbit, N-His tag TG65092-NH
FAM126B cDNA ORF Clone, Rabbit, C-HA tag TG65092-CY
FAM126B cDNA ORF Clone, Rabbit, N-HA tag TG65092-NY
FAM126B cDNA ORF Clone, Rabbit, C-Myc tag TG65092-CM
FAM126B cDNA ORF Clone, Rabbit, N-Myc tag TG65092-NM

FAM126B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM126B cDNA ORF Clone in Cloning Vector, Mouse MG52548-G
FAM126B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52548-ACG
FAM126B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52548-ACGLN
FAM126B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52548-ANG
FAM126B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52548-ACR
FAM126B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52548-ANR
FAM126B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52548-CF
FAM126B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52548-NF
FAM126B cDNA ORF Clone, Mouse, C-His tag MG52548-CH
FAM126B cDNA ORF Clone, Mouse, N-His tag MG52548-NH
FAM126B cDNA ORF Clone, Mouse, C-HA tag MG52548-CY
FAM126B cDNA ORF Clone, Mouse, N-HA tag MG52548-NY
FAM126B cDNA ORF Clone, Mouse, C-Myc tag MG52548-CM
FAM126B cDNA ORF Clone, Mouse, N-Myc tag MG52548-NM
FAM126B qPCR Primer Pairs, Mouse MP202421
info info
添加购物车成功! 添加购物车失败!