FAM103A1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51491-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM103A1 Reagents
CRO Services
Product recommended

All FAM103A1 Reagents
FAM103A1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
360 bp
Description
Full length Clone DNA of Mouse family with sequence similarity 103, member A1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM103A1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2410047I02Rik cDNA ORF Clone, Mouse;2610204K14Rik cDNA ORF Clone, Mouse;RAM cDNA ORF Clone, Mouse
FAM103A1 Background Information
Full Name
family with sequence similarity 103, member A1

FAM103A1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
FAM103A1 cDNA ORF Clone in Cloning Vector, Rabbit TG65057-G
FAM103A1 cDNA ORF Clone, Rabbit, untagged TG65057-UT
FAM103A1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65057-ACG
FAM103A1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65057-ANG
FAM103A1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65057-ACR
FAM103A1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65057-ANR
FAM103A1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65057-CF
FAM103A1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65057-NF
FAM103A1 cDNA ORF Clone, Rabbit, C-His tag TG65057-CH
FAM103A1 cDNA ORF Clone, Rabbit, N-His tag TG65057-NH
FAM103A1 cDNA ORF Clone, Rabbit, C-HA tag TG65057-CY
FAM103A1 cDNA ORF Clone, Rabbit, N-HA tag TG65057-NY
FAM103A1 cDNA ORF Clone, Rabbit, C-Myc tag TG65057-CM
FAM103A1 cDNA ORF Clone, Rabbit, N-Myc tag TG65057-NM

FAM103A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM103A1 cDNA ORF Clone in Cloning Vector, Mouse MG51491-U
FAM103A1 cDNA ORF Clone, Mouse, untagged MG51491-UT
FAM103A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51491-ACG
FAM103A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51491-ACGLN
FAM103A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51491-ANG
FAM103A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51491-ACR
FAM103A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51491-ANR
FAM103A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51491-CF
FAM103A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51491-NF
FAM103A1 cDNA ORF Clone, Mouse, C-His tag MG51491-CH
FAM103A1 cDNA ORF Clone, Mouse, C-HA tag MG51491-CY
FAM103A1 cDNA ORF Clone, Mouse, N-HA tag MG51491-NY
FAM103A1 cDNA ORF Clone, Mouse, C-Myc tag MG51491-CM
FAM103A1 cDNA ORF Clone, Mouse, N-Myc tag MG51491-NM
FAM103A1 qPCR Primer Pairs, Mouse MP201375
info info
添加购物车成功! 添加购物车失败!