FAIM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52884-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAIM2 Reagents
CRO Services
Product recommended

All FAIM2 Reagents
FAIM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Mouse Fas apoptotic inhibitory molecule 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAIM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2900002L20Rik cDNA ORF Clone, Mouse;Lfg cDNA ORF Clone, Mouse;Lfg2 cDNA ORF Clone, Mouse;NMP25 cDNA ORF Clone, Mouse;Nmp35 cDNA ORF Clone, Mouse;Tmbim2 cDNA ORF Clone, Mouse
FAIM2 Background Information
Full Name
Fas apoptotic inhibitory molecule 2

FAIM2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
FAIM2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90433-G
FAIM2 cDNA ORF Clone, Cynomolgus, untagged CG90433-UT
FAIM2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90433-ACG
FAIM2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90433-ACGLN
FAIM2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90433-ACR
FAIM2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90433-CF
FAIM2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90433-NF
FAIM2 cDNA ORF Clone, Cynomolgus, C-His tag CG90433-CH
FAIM2 cDNA ORF Clone, Cynomolgus, N-His tag CG90433-NH
FAIM2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90433-CY
FAIM2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90433-NY
FAIM2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90433-CM
FAIM2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90433-NM

FAIM2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAIM2 cDNA ORF Clone in Cloning Vector, Mouse MG52884-G
FAIM2 cDNA ORF Clone, Mouse, untagged MG52884-UT
FAIM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52884-ACGLN
FAIM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52884-ACG
FAIM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52884-ANG
FAIM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52884-ACR
FAIM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52884-ANR
FAIM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52884-NF
FAIM2 cDNA ORF Clone, Mouse, C-His tag MG52884-CH
FAIM2 cDNA ORF Clone, Mouse, N-His tag MG52884-NH
FAIM2 cDNA ORF Clone, Mouse, C-HA tag MG52884-CY
FAIM2 cDNA ORF Clone, Mouse, N-HA tag MG52884-NY
FAIM2 cDNA ORF Clone, Mouse, C-Myc tag MG52884-CM
FAIM2 cDNA ORF Clone, Mouse, N-Myc tag MG52884-NM

FAIM2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAIM2 cDNA ORF Clone in Cloning Vector, Human HG20783-U
FAIM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20783-ACGLN
info info
添加购物车成功! 添加购物车失败!