FAHD1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52949-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FAHD1 Reagents
CRO Services
Product recommended

All FAHD1 Reagents
FAHD1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
684 bp
Description
Full length Clone DNA of Mouse fumarylacetoacetate hydrolase domain containing 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAHD1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1110025H10Rik cDNA ORF Clone, Mouse;AV002085 cDNA ORF Clone, Mouse
FAHD1 Background Information
Full Name
fumarylacetoacetate hydrolase domain containing 1

FAHD1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FAHD1 cDNA ORF Clone in Cloning Vector, Rat RG81590-G

FAHD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAHD1 cDNA ORF Clone in Cloning Vector, Mouse MG52949-G
FAHD1 cDNA ORF Clone, Mouse, untagged MG52949-UT
FAHD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52949-ACG
FAHD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52949-ACGLN
FAHD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52949-ANG
FAHD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52949-ACR
FAHD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52949-ANR
FAHD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52949-CF
FAHD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52949-NF
FAHD1 cDNA ORF Clone, Mouse, C-His tag MG52949-CH
FAHD1 cDNA ORF Clone, Mouse, N-His tag MG52949-NH
FAHD1 cDNA ORF Clone, Mouse, C-HA tag MG52949-CY
FAHD1 cDNA ORF Clone, Mouse, C-Myc tag MG52949-CM
FAHD1 cDNA ORF Clone, Mouse, N-Myc tag MG52949-NM

FAHD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAHD1 cDNA ORF Clone in Cloning Vector, Human HG15239-G
FAHD1 cDNA ORF Clone, Human, untagged HG15239-UT
FAHD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15239-ACG
FAHD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15239-ACGLN
FAHD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15239-ANG
FAHD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15239-ACR
FAHD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15239-ANR
FAHD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15239-CF
FAHD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15239-NF
FAHD1 cDNA ORF Clone, Human, C-His tag HG15239-CH
FAHD1 cDNA ORF Clone, Human, N-His tag HG15239-NH
FAHD1 cDNA ORF Clone, Human, C-HA tag HG15239-CY
FAHD1 cDNA ORF Clone, Human, N-HA tag HG15239-NY
FAHD1 cDNA ORF Clone, Human, C-Myc tag HG15239-CM
FAHD1 cDNA ORF Clone, Human, N-Myc tag HG15239-NM
FAHD1 qPCR Primer Pairs, Human HP103865
info info
添加购物车成功! 添加购物车失败!