Quick Order

Mouse FABP4 /A-FABP Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse FABP4 cDNA Clone Product Information
NCBI RefSeq:NM_024406.2
RefSeq ORF Size:399bp
cDNA Description:Full length Clone DNA of Mus musculus fatty acid binding protein 4, adipocyte with C terminal Myc tag.
Gene Synonym:Ap2, Lbpl, 422/aP2, ALBP/Ap2, Fabp4
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mouse fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte lipid-binding protein, and FABP4, is a cytoplasm protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. In familial combined hyperlipidemia (FCHL), FABP4 correlated to body mass index (BMI), waist circumference and homeostasis model assessment (HOMA) index.FABP4 levels were associated with triglyceride-rich lipoproteins. In humans serum FABP4 levels correlate significantly with features of PCOS. It appears to be a determinant of atherogenic dyslipidemia. FABP4 pathway mediates the sebaceous gland hyperplasia in keratinocyte-specific Pten-null mice. FABP4 concentration significantly increased with an increasing of MS features and was strongly correlated with body-mass index, triglycerides, HDL-cholesterol concentrations and blood pressure. Patients in the highest quartile of FABP4 presented a six-fold increased odds ratio for MS and a three-fold increased odds for LD, adjusted by age, sex, body-mass index and the antiretroviral therapy. FABP4 is a strong plasma marker of metabolic disturbances in HIV-infected patients, and therefore, could serve to guide therapeutic intervention in this group of patients.

References
  • van Dongen,M.J. et al., 2002, J Am Chem Soc. 124 (40): 11874-80.
  • Coll, B. et al., 2008, Atherosclerosis  199 (1):147-53.
  • Hoashi,S. et al., 2008, BMC Genet. 9 :84.
  • Cai,H. et al., 2010, Bioorg Med Chem Lett  20 (12):3675-9.
  • Size / Price
    Catalog: MG50652-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"