FABP3 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51233-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FABP3 Reagents
CRO Services
Product recommended

All FABP3 Reagents
FABP3 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
402 bp
Description
Full length Clone DNA of Mouse fatty acid binding protein 3, muscle and heart with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FABP3 cDNA ORF Clone, Mouse, C-His tag Alternative Names
Fabph-1 cDNA ORF Clone, Mouse;Fabph-4 cDNA ORF Clone, Mouse;Fabph1 cDNA ORF Clone, Mouse;Fabph4 cDNA ORF Clone, Mouse;H-FABP cDNA ORF Clone, Mouse;Mdgi cDNA ORF Clone, Mouse
FABP3 Background Information
Full Name
fatty acid binding protein 3

FABP3 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
FABP3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90397-G
FABP3 cDNA ORF Clone, Cynomolgus, untagged CG90397-UT
FABP3 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90397-ACGLN
FABP3 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90397-ACG
FABP3 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90397-ANG
FABP3 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90397-ACR
FABP3 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90397-ANR
FABP3 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90397-CF
FABP3 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90397-NF
FABP3 cDNA ORF Clone, Cynomolgus, C-His tag CG90397-CH
FABP3 cDNA ORF Clone, Cynomolgus, N-His tag CG90397-NH
FABP3 cDNA ORF Clone, Cynomolgus, C-HA tag CG90397-CY
FABP3 cDNA ORF Clone, Cynomolgus, N-HA tag CG90397-NY
FABP3 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90397-CM
FABP3 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90397-NM

FABP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FABP3 cDNA ORF Clone in Cloning Vector, Rat RG80738-G
FABP3 cDNA ORF Clone, Rat, untagged RG80738-UT
FABP3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80738-ACG
FABP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80738-ACGLN
FABP3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80738-ANG
FABP3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80738-ACR
FABP3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80738-ANR
FABP3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80738-CF
FABP3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80738-NF
FABP3 cDNA ORF Clone, Rat, C-His tag RG80738-CH
FABP3 cDNA ORF Clone, Rat, N-His tag RG80738-NH
FABP3 cDNA ORF Clone, Rat, C-HA tag RG80738-CY
FABP3 cDNA ORF Clone, Rat, N-HA tag RG80738-NY
FABP3 cDNA ORF Clone, Rat, C-Myc tag RG80738-CM
FABP3 cDNA ORF Clone, Rat, N-Myc tag RG80738-NM
FABP3 qPCR Primer Pairs, Rat RP300702

FABP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FABP3 cDNA ORF Clone in Cloning Vector, Mouse MG51233-U
FABP3 cDNA ORF Clone, Mouse, untagged MG51233-UT
FABP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51233-ACGLN
FABP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51233-ACG
FABP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51233-ANG
FABP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51233-ACR
FABP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51233-ANR
FABP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51233-CF
FABP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51233-NF
FABP3 cDNA ORF Clone, Mouse, N-His tag MG51233-NH
FABP3 cDNA ORF Clone, Mouse, C-HA tag MG51233-CY
FABP3 cDNA ORF Clone, Mouse, N-HA tag MG51233-NY
FABP3 cDNA ORF Clone, Mouse, C-Myc tag MG51233-CM
FABP3 cDNA ORF Clone, Mouse, N-Myc tag MG51233-NM
FABP3 qPCR Primer Pairs, Mouse MP201116

FABP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FABP3 cDNA ORF Clone, Human, untagged HG12476-UT
FABP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12476-ACGLN
FABP3 qPCR Primer Pairs, Human HP104804
info info
添加购物车成功! 添加购物车失败!