Factor IX cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50362-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Factor IX Reagents
CRO Services
Product recommended

All Factor IX Reagents
Factor IX cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Mouse coagulation factor IX with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor IX cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AW111646 cDNA ORF Clone, Mouse;Cf-9 cDNA ORF Clone, Mouse;Cf9 cDNA ORF Clone, Mouse
Factor IX Background Information

Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.

Full Name
coagulation factor IX
References
  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
  • Factor IX cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Factor IX cDNA ORF Clone in Cloning Vector, Rat RG81664-G
    Factor IX cDNA ORF Clone, Rat, untagged RG81664-UT
    Factor IX cDNA ORF Clone, Rat, C-GFPSpark® tag RG81664-ACG
    Factor IX Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81664-ACGLN
    Factor IX cDNA ORF Clone, Rat, C-OFPSpark® tag RG81664-ACR
    Factor IX cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81664-CF
    Factor IX cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81664-NF
    Factor IX cDNA ORF Clone, Rat, C-His tag RG81664-CH
    Factor IX cDNA ORF Clone, Rat, N-His tag RG81664-NH
    Factor IX cDNA ORF Clone, Rat, C-HA tag RG81664-CY
    Factor IX cDNA ORF Clone, Rat, N-HA tag RG81664-NY
    Factor IX cDNA ORF Clone, Rat, C-Myc tag RG81664-CM
    Factor IX cDNA ORF Clone, Rat, N-Myc tag RG81664-NM

    Factor IX cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Factor IX cDNA ORF Clone in Cloning Vector, Mouse MG50362-G
    Factor IX cDNA ORF Clone, Mouse, untagged MG50362-UT
    Factor IX cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50362-ACG
    Factor IX Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50362-ACGLN
    Factor IX cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50362-ACR
    Factor IX cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50362-CF
    Factor IX cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50362-NF
    Factor IX cDNA ORF Clone, Mouse, C-His tag MG50362-CH
    Factor IX cDNA ORF Clone, Mouse, N-His tag MG50362-NH
    Factor IX cDNA ORF Clone, Mouse, C-HA tag MG50362-CY
    Factor IX cDNA ORF Clone, Mouse, N-HA tag MG50362-NY
    Factor IX cDNA ORF Clone, Mouse, C-Myc tag MG50362-CM
    Factor IX qPCR Primer Pairs, Mouse MP200383

    Factor IX cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Factor IX cDNA ORF Clone in Cloning Vector, Human HG11503-M
    Factor IX cDNA ORF Clone, Human, untagged HG11503-UT
    Factor IX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11503-ACGLN
    Factor IX cDNA ORF Clone, Human, C-GFPSpark® tag HG11503-ACG
    Factor IX cDNA ORF Clone, Human, C-OFPSpark® tag HG11503-ACR
    Factor IX cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11503-CF
    Factor IX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11503-NF
    Factor IX cDNA ORF Clone, Human, C-His tag HG11503-CH
    Factor IX cDNA ORF Clone, Human, N-His tag HG11503-NH
    Factor IX cDNA ORF Clone, Human, C-HA tag HG11503-CY
    Factor IX cDNA ORF Clone, Human, N-HA tag HG11503-NY
    Factor IX cDNA ORF Clone, Human, C-Myc tag HG11503-CM
    Factor IX cDNA ORF Clone, Human, N-Myc tag HG11503-NM
    Factor IX qPCR Primer Pairs, Human HP101377
    info info
    添加购物车成功! 添加购物车失败!