After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse Coagulation Factor IX / FIX / F9 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse F9 cDNA Clone Product Information
NCBI RefSeq:NM_007979.1
RefSeq ORF Size:1416bp
cDNA Description:Full length Clone DNA of Mus musculus coagulation factor IX.
Gene Synonym:Cf9, Cf-9, AW111646, F9
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.

References
  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
  • Size / Price
    Catalog: MG50362-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"