Text Size:AAA

Mouse Coagulation Factor IX / FIX / F9 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse F9 cDNA Clone Product Information
    NCBI RefSeq:NM_007979.1
    RefSeq ORF Size:1416bp
    cDNA Description:Full length Clone DNA of Mus musculus coagulation factor IX with C terminal HA tag.
    Gene Synonym:Cf9, Cf-9, AW111646, F9
    Species:Mouse
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with F9 qPCR primers for gene expression analysis, MP200383 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein which belongs to the peptidase S1 family. Coagulation factor IX / F9 contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one?peptidase S1 domain. Coagulation factor IX / F9 is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ons, phospholipids, and factor VIIIa. Defects in Coagulation factor IX / F9 are the cause of thrombophilia due to factor IX defect which is a hemostatic disorder characterized by a tendency to thrombosis. Defects in Coagulation factor IX / F9 are also the cause of recessive X-linked hemophilia B ( HEMB ) which also known as Christmas disease.

    References
  • Onay U.V., et al., 2003, Br. J. Haematol. 120:656-659.
  • Vidal F., et al., 2000, Br. J. Haematol. 111:549-551.
  • Simioni P., et al., 2009, N. Engl. J. Med. 361:1671-1675.
  • Espinos C., et al., 2009, Haematologica 88:235-236.
  • Size / Price
    Catalog: MG50362-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"