Thrombin cDNA ORF Clone, Mouse, untagged

Cat: MG50344-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Thrombin Reagents
CRO Services
Product recommended

All Thrombin Reagents
Thrombin cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1857 bp
Description
Full length Clone DNA of Mouse coagulation factor II.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thrombin cDNA ORF Clone, Mouse, untagged Alternative Names
Cf-2 cDNA ORF Clone, Mouse;Cf2 cDNA ORF Clone, Mouse;FII cDNA ORF Clone, Mouse
Thrombin Background Information

Coagulation Factor II Protein (FII, F2 Protein or Prothrombin) is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. Coagulation Factor II Protein (FII, F2 Protein) also plays a role in maintaining vascular integrity during development and postnatal life. Prothrombin / Coagulation Factor II is activated on the surface of a phospholipid membrane that binds the amino end of prothrombin / Coagulation Factor II and factor Va and Xa in Ca-dependent interactions; factor Xa removes the activation peptide and cleaves the remaining part into light and heavy chains. The activation process starts slowly because factor V itself has to be activated by the initial, small amounts of thrombin. Prothrombin / Coagulation Factor II is expressed by the liver and secreted in plasma. Defects in prothrombin / Coagulation Factor II are the cause of factor II deficiency (FA2D). It is very rare blood coagulation disorder characterized by mucocutaneous bleeding symptoms. The severity of the bleeding manifestations correlates with blood factor II levels. Defects in Coagulation Factor II are also a cause of susceptibility to thrombosis. It is a multifactorial disorder of hemostasis characterized by abnormal platelet aggregation in response to various agents and recurrent thrombi formation.

Full Name
coagulation factor II (thrombin)
References
  • Danneberg J, et al. (1998) Reliable genotyping of the G-20210-A mutation of Coagulation Factor II (prothrombin). Clin Chem. 44(2): 349-51.
  • Redondo M, et al. (1999) Coagulation Factor s II, V, VII, and X, prothrombin gene 20210GA transition, and factor V Leiden in coronary artery disease: high factor V clotting activity is an independent risk factor for myocardial infarction. Arterioscler Thromb Vasc Biol. 19(4): 1020-5.
  • Miletich JP, et al. (1980) The synthesis of sulfated dextran beads for isolation of human plasma Coagulation Factor s II, IX, and X. Anal Biochem. 105(2): 304-10.
  • Thrombin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Thrombin cDNA ORF Clone in Cloning Vector, Rat RG80722-U
    Thrombin cDNA ORF Clone, Rat, untagged RG80722-UT
    Thrombin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80722-ACG
    Thrombin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80722-ACGLN
    Thrombin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80722-ACR
    Thrombin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80722-CF
    Thrombin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80722-NF
    Thrombin cDNA ORF Clone, Rat, C-His tag RG80722-CH
    Thrombin cDNA ORF Clone, Rat, N-His tag RG80722-NH
    Thrombin cDNA ORF Clone, Rat, C-HA tag RG80722-CY
    Thrombin cDNA ORF Clone, Rat, N-HA tag RG80722-NY
    Thrombin cDNA ORF Clone, Rat, C-Myc tag RG80722-CM
    Thrombin cDNA ORF Clone, Rat, N-Myc tag RG80722-NM
    Thrombin qPCR Primer Pairs, Rat RP300686

    Thrombin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Thrombin cDNA ORF Clone in Cloning Vector, Mouse MG50344-M
    Thrombin cDNA ORF Clone, Mouse, untagged MG53177-UT
    Thrombin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50344-ACGLN
    Thrombin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50344-ACG
    Thrombin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50344-ACR
    Thrombin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50344-CF
    Thrombin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50344-NF
    Thrombin cDNA ORF Clone, Mouse, C-His tag MG50344-CH
    Thrombin cDNA ORF Clone, Mouse, N-His tag MG50344-NH
    Thrombin cDNA ORF Clone, Mouse, C-HA tag MG50344-CY
    Thrombin cDNA ORF Clone, Mouse, N-HA tag MG50344-NY
    Thrombin cDNA ORF Clone, Mouse, C-Myc tag MG50344-CM
    Thrombin cDNA ORF Clone, Mouse, N-Myc tag MG50344-NM
    Thrombin qPCR Primer Pairs, Mouse MP200366

    Thrombin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Thrombin cDNA ORF Clone in Cloning Vector, Human HG11505-M
    Thrombin cDNA ORF Clone, Human, untagged HG11505-UT
    Thrombin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11505-ACGLN
    Thrombin cDNA ORF Clone, Human, C-GFPSpark® tag HG11505-ACG
    Thrombin cDNA ORF Clone, Human, C-OFPSpark® tag HG11505-ACR
    Thrombin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11505-CF
    Thrombin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11505-NF
    Thrombin cDNA ORF Clone, Human, C-His tag HG11505-CH
    Thrombin cDNA ORF Clone, Human, N-His tag HG11505-NH
    Thrombin cDNA ORF Clone, Human, C-HA tag HG11505-CY
    Thrombin cDNA ORF Clone, Human, N-HA tag HG11505-NY
    Thrombin cDNA ORF Clone, Human, C-Myc tag HG11505-CM
    Thrombin cDNA ORF Clone, Human, N-Myc tag HG11505-NM
    Thrombin qPCR Primer Pairs, Human HP101378
    info info
    添加购物车成功! 添加购物车失败!