Factor XI cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50237-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Factor XI Reagents
CRO Services
Product recommended

All Factor XI Reagents
Factor XI cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1875 bp
Description
Full length Clone DNA of Mouse coagulation factor XI with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor XI cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1600027G01Rik cDNA ORF Clone, Mouse;AI503996 cDNA ORF Clone, Mouse;Cf11 cDNA ORF Clone, Mouse;FXI cDNA ORF Clone, Mouse;PTA cDNA ORF Clone, Mouse
Factor XI Background Information

Factor XI (plasma thromboplastin antecedent) is a plasma glycoprotein, and a zymogen acting as a serine protease which participates in blood coagulation as a catalyst in the conversion of factor IX to factor IXa in the presence of calcium ions. It is an unusual dimeric protease, with structural features that distinguish it from vitamin K-dependent coagulation proteases. The factor XI is synthesized in the liver as a single polypeptide chain with a molecular weight estimated between 125 ~160 kDa and then is processed into a disulfide-bond linked homodimer. FXI is a homodimer, with each subunit containing four apple domains and a protease domain. The apple domains form a disk structure with binding sites for platelets, high molecular weight kininogen, and the substrate factor IX (FIX). FXI is converted to the active protease FXIa by cleavage of the Arg369-Ile370 bond on each subunit. After the activation reaction, Factor XIa is composed of two heavy and two light chains held together by three disulfide bonds. The heavy chains are derived from the amino termini of the zymogen and responsible for the binding of factor XI to high molecular weight kininogen and for the activation of factor IX, while the light chain contains the catalytic portion of the enzyme and is homologous to the trypsin family of serine proteases. FXI deficiency is a disorder characterized by a mild or no bleeding tendency. Severe FXI deficiency is an injury-related bleeding disorder common in Ashkenazi Jews and rare worldwide.

Full Name
coagulation factor XI
References
  • Gailani D, et al. (2009) Structural and functional features of factor XI. J Thromb Haemost. 7 Suppl 1: 75-8.
  • Duga S, et al. (2009) Factor XI Deficiency. Semin Thromb Hemost. 35(4): 416-25.
  • Emsley J, et al. (2010) Structure and function of factor XI. Blood. 115(13): 2569-77.
  • Factor XI cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Factor XI cDNA ORF Clone in Cloning Vector, Rat RG84371-U
    Factor XI Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84371-ACGLN

    Factor XI cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Factor XI cDNA ORF Clone in Cloning Vector, Mouse MG50237-M
    Factor XI cDNA ORF Clone, Mouse, untagged MG50237-UT
    Factor XI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50237-ACG
    Factor XI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50237-ACGLN
    Factor XI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50237-ACR
    Factor XI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50237-CF
    Factor XI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50237-NF
    Factor XI cDNA ORF Clone, Mouse, C-His tag MG50237-CH
    Factor XI cDNA ORF Clone, Mouse, N-His tag MG50237-NH
    Factor XI cDNA ORF Clone, Mouse, C-HA tag MG50237-CY
    Factor XI cDNA ORF Clone, Mouse, N-HA tag MG50237-NY
    Factor XI cDNA ORF Clone, Mouse, C-Myc tag MG50237-CM
    Factor XI qPCR Primer Pairs, Mouse MP200263

    Factor XI cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Factor XI cDNA ORF Clone in Cloning Vector, Human HG10302-M
    Factor XI cDNA ORF Clone, Human, untagged HG10302-UT
    Factor XI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10302-ACGLN
    Factor XI cDNA ORF Clone, Human, C-GFPSpark® tag HG10302-ACG
    Factor XI cDNA ORF Clone, Human, C-OFPSpark® tag HG10302-ACR
    Factor XI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10302-CF
    Factor XI cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10302-NF
    Factor XI cDNA ORF Clone, Human, C-His tag HG10302-CH
    Factor XI cDNA ORF Clone, Human, N-His tag HG10302-NH
    Factor XI cDNA ORF Clone, Human, C-HA tag HG10302-CY
    Factor XI cDNA ORF Clone, Human, N-HA tag HG10302-NY
    Factor XI cDNA ORF Clone, Human, C-Myc tag HG10302-CM
    Factor XI cDNA ORF Clone, Human, N-Myc tag HG10302-NM
    Factor XI qPCR Primer Pairs, Human HP100345
    info info
    添加购物车成功! 添加购物车失败!