EphA6 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50630-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EphA6 Reagents
CRO Services
Product recommended

All EphA6 Reagents
EphA6 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3108 bp
Description
Full length Clone DNA of Mouse Eph receptor A6 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EphA6 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Ehk2 cDNA ORF Clone, Mouse;Hek12 cDNA ORF Clone, Mouse;m-ehk2 cDNA ORF Clone, Mouse
EphA6 Background Information

Ephrin type-A receptor 6, also known as EphA6 or EHK2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Eph receptor−mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. In the vomeronasal system, Ephrin-A5/EphA6 interactions mediate attraction or adhesion rather than repulsion.

Full Name
EPH receptor A6
References
  • Wilkinson DG. (2000) Eph receptors and ephrins: regulators of guidance and assembly. Int Rev Cytol. 196: 177-244.
  • Yamaguchi Y, et al. (2004) Eph receptors in the adult brain. Curr Opin Neurobiol. 14 (3): 288-96.
  • Hafner C, et al. (2004) Differential gene expression of Eph receptors and ephrins in benign human tissues and cancers. Clin Chem. 50 (3): 490-9.
  • EphA6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EphA6 cDNA ORF Clone in Cloning Vector, Mouse MG50630-M
    EphA6 cDNA ORF Clone, Mouse, untagged MG50630-UT
    EphA6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50630-ACGLN
    EphA6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50630-ACG
    EphA6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50630-ACR
    EphA6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50630-CF
    EphA6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50630-NF
    EphA6 cDNA ORF Clone, Mouse, C-His tag MG50630-CH
    EphA6 cDNA ORF Clone, Mouse, N-His tag MG50630-NH
    EphA6 cDNA ORF Clone, Mouse, C-HA tag MG50630-CY
    EphA6 cDNA ORF Clone, Mouse, C-Myc tag MG50630-CM
    EphA6 cDNA ORF Clone, Mouse, N-Myc tag MG50630-NM
    EphA6 qPCR Primer Pairs, Mouse MP200612

    EphA6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EphA6 cDNA ORF Clone in Cloning Vector, Human HG16039-G
    EphA6 cDNA ORF Clone, Human, untagged HG16039-UT
    EphA6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16039-ACG
    EphA6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16039-ACGLN
    EphA6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16039-ACR
    EphA6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16039-CF
    EphA6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16039-NF
    EphA6 cDNA ORF Clone, Human, C-His tag HG16039-CH
    EphA6 cDNA ORF Clone, Human, N-His tag HG16039-NH
    EphA6 cDNA ORF Clone, Human, C-HA tag HG16039-CY
    EphA6 cDNA ORF Clone, Human, N-HA tag HG16039-NY
    EphA6 cDNA ORF Clone, Human, C-Myc tag HG16039-CM
    EphA6 cDNA ORF Clone, Human, N-Myc tag HG16039-NM
    info info
    添加购物车成功! 添加购物车失败!