Quick Order

Mouse EphA6 / EHK2 / Eph Receptor A6 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse EPHA6 cDNA Clone Product Information
NCBI RefSeq:NM_007938.2
RefSeq ORF Size:3108bp
cDNA Description:Full length Clone DNA of Mus musculus Eph receptor A6 with N terminal HA tag.
Gene Synonym:Ehk2, Hek12, m-ehk2, Epha6
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Ephrin type-A receptor 6, also known as EphA6 or EHK2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Eph receptor−mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. In the vomeronasal system, Ephrin-A5/EphA6 interactions mediate attraction or adhesion rather than repulsion.

References
  • Wilkinson DG. (2000) Eph receptors and ephrins: regulators of guidance and assembly. Int Rev Cytol. 196: 177-244.
  • Yamaguchi Y, et al. (2004) Eph receptors in the adult brain. Curr Opin Neurobiol. 14 (3): 288-96.
  • Hafner C, et al. (2004) Differential gene expression of Eph receptors and ephrins in benign human tissues and cancers. Clin Chem. 50 (3): 490-9.
  • Size / Price
    Catalog: MG50630-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"